ID: 1097697190

View in Genome Browser
Species Human (GRCh38)
Location 12:62786322-62786344
Sequence TCCTTTCCTCTCCCGCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 1, 2: 3, 3: 27, 4: 367}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097697190_1097697195 -4 Left 1097697190 12:62786322-62786344 CCCTGAGGCGGGAGAGGAAAGGA 0: 1
1: 1
2: 3
3: 27
4: 367
Right 1097697195 12:62786341-62786363 AGGAGGGGTAGCAGATGTGCTGG 0: 1
1: 0
2: 2
3: 23
4: 249
1097697190_1097697197 25 Left 1097697190 12:62786322-62786344 CCCTGAGGCGGGAGAGGAAAGGA 0: 1
1: 1
2: 3
3: 27
4: 367
Right 1097697197 12:62786370-62786392 TCCATCTGTCCCCATCCTGGAGG 0: 1
1: 0
2: 1
3: 33
4: 243
1097697190_1097697199 30 Left 1097697190 12:62786322-62786344 CCCTGAGGCGGGAGAGGAAAGGA 0: 1
1: 1
2: 3
3: 27
4: 367
Right 1097697199 12:62786375-62786397 CTGTCCCCATCCTGGAGGTACGG 0: 1
1: 1
2: 11
3: 38
4: 435
1097697190_1097697196 22 Left 1097697190 12:62786322-62786344 CCCTGAGGCGGGAGAGGAAAGGA 0: 1
1: 1
2: 3
3: 27
4: 367
Right 1097697196 12:62786367-62786389 TTTTCCATCTGTCCCCATCCTGG 0: 1
1: 1
2: 3
3: 18
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097697190 Original CRISPR TCCTTTCCTCTCCCGCCTCA GGG (reversed) Intronic