ID: 1097697190

View in Genome Browser
Species Human (GRCh38)
Location 12:62786322-62786344
Sequence TCCTTTCCTCTCCCGCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 1, 2: 3, 3: 27, 4: 367}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097697190_1097697195 -4 Left 1097697190 12:62786322-62786344 CCCTGAGGCGGGAGAGGAAAGGA 0: 1
1: 1
2: 3
3: 27
4: 367
Right 1097697195 12:62786341-62786363 AGGAGGGGTAGCAGATGTGCTGG 0: 1
1: 0
2: 2
3: 23
4: 249
1097697190_1097697199 30 Left 1097697190 12:62786322-62786344 CCCTGAGGCGGGAGAGGAAAGGA 0: 1
1: 1
2: 3
3: 27
4: 367
Right 1097697199 12:62786375-62786397 CTGTCCCCATCCTGGAGGTACGG 0: 1
1: 1
2: 11
3: 38
4: 435
1097697190_1097697197 25 Left 1097697190 12:62786322-62786344 CCCTGAGGCGGGAGAGGAAAGGA 0: 1
1: 1
2: 3
3: 27
4: 367
Right 1097697197 12:62786370-62786392 TCCATCTGTCCCCATCCTGGAGG 0: 1
1: 0
2: 1
3: 33
4: 243
1097697190_1097697196 22 Left 1097697190 12:62786322-62786344 CCCTGAGGCGGGAGAGGAAAGGA 0: 1
1: 1
2: 3
3: 27
4: 367
Right 1097697196 12:62786367-62786389 TTTTCCATCTGTCCCCATCCTGG 0: 1
1: 1
2: 3
3: 18
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097697190 Original CRISPR TCCTTTCCTCTCCCGCCTCA GGG (reversed) Intronic
901530254 1:9848555-9848577 TTCTTTCATCTCCCTCCTCCAGG - Exonic
901869028 1:12126665-12126687 TCCTTTCCCCTCCTGCCCCTGGG - Intronic
902551370 1:17221609-17221631 TCCTTCCCTCACCCTCTTCAAGG - Intronic
903275617 1:22219464-22219486 GCCTTTCCTCTTCTGCCTCTGGG + Intergenic
903321060 1:22543430-22543452 GCCTTCCCTTTCCCGGCTCAGGG - Intergenic
904329287 1:29747439-29747461 TCCTTGCCTCTCCCTGCCCAGGG + Intergenic
904881088 1:33697616-33697638 TCCCTTCCTCTCCCTCCTGTTGG + Intronic
904946124 1:34199974-34199996 TTCTTCCCTCTGCCACCTCATGG + Intronic
906191851 1:43904140-43904162 TCCTTGTCTCTCCCTCCTCTAGG - Intronic
907481493 1:54748297-54748319 TCCTTCCCTCTGCGGGCTCAGGG - Intergenic
907559850 1:55378501-55378523 TTCTCTCCTCTCCCTCCCCATGG + Intergenic
907665964 1:56434109-56434131 TGCTTTCGTCCCCAGCCTCATGG - Intergenic
909341689 1:74539133-74539155 TCCATCTCTCTCCAGCCTCAAGG - Intronic
909401270 1:75233728-75233750 GCCTTTGGTCTCCTGCCTCATGG - Intronic
909549036 1:76877812-76877834 ACCTTTACTGTCCTGCCTCAGGG - Intronic
909576824 1:77185210-77185232 ACCTTTACTGTCCTGCCTCAGGG + Intronic
910433615 1:87182655-87182677 TCCTCTCCTCTCTCTCCTTATGG + Intergenic
910449189 1:87329272-87329294 TCCCTCCCTCTCCCACCTCCCGG - Intronic
911257415 1:95648013-95648035 ACCTTTGCTGTCCTGCCTCAGGG - Intergenic
912427333 1:109606168-109606190 CCTTTTCCTCTCCCACTTCACGG - Exonic
913241746 1:116835801-116835823 TCCTTTCTTCTCCCTCCACGGGG - Intergenic
914755008 1:150557525-150557547 CCAGTTCCTCTCCCGACTCACGG - Exonic
915292929 1:154898356-154898378 CCCTTCTCTCTCCCGTCTCAAGG + Intergenic
915357352 1:155263268-155263290 TCCTTTCTTCGCCCGCCTTCGGG - Exonic
918043333 1:180926505-180926527 TCCTTTCTGCTCCCTCCTCTTGG - Intronic
920498414 1:206471271-206471293 TCCCCTCCCCTCCCTCCTCAGGG - Intronic
922573246 1:226645955-226645977 TCCTTTCTTCTCTCTCCTCCTGG - Intronic
1063670370 10:8095292-8095314 TCCTTTTCTCTCCCATCTCCTGG - Intergenic
1063996674 10:11626321-11626343 GCCTTTCGGCTCCCGTCTCAGGG - Intergenic
1066367772 10:34793330-34793352 TCCTTCCCTCTCCCTGATCATGG - Intronic
1068886678 10:62104976-62104998 TCCTTTGCTCTCCTCCCTAAAGG - Intergenic
1069192399 10:65507030-65507052 ACCTTTACTCTCCTACCTCAGGG - Intergenic
1069747727 10:70726465-70726487 TCCTTTCTTCTCCTGCCCCCGGG + Intronic
1069983027 10:72265605-72265627 TCCTATCCTCTCACTCCACAGGG + Intergenic
1070268746 10:74931236-74931258 TCCTTTCCTCTCCTGTCCCTGGG + Intronic
1070771056 10:79082567-79082589 TCCTTCCCTCTCTGGCCTCAGGG - Intronic
1071997229 10:91161163-91161185 TCTTTGCCCCTCCAGCCTCAGGG + Intergenic
1072263973 10:93709964-93709986 TCCCTTCCCCTCCCTCATCAGGG - Intergenic
1072714027 10:97737432-97737454 GCCTTCCCTGTCCAGCCTCACGG + Intronic
1074853128 10:117454598-117454620 TCCTCACCTCTCCCTGCTCAGGG + Intergenic
1075037309 10:119080379-119080401 TCCTTCCCCCTGCCGCCTCCGGG - Intronic
1075191625 10:120314964-120314986 TCCTTTCCTCTTCCAGCTCGTGG + Intergenic
1075403765 10:122180268-122180290 TCCTTCCCCCTCCCACCTCAGGG + Intronic
1075910273 10:126118744-126118766 TTCATCCCTCTCCCGCCTCTTGG + Intronic
1076123119 10:127952077-127952099 ACCTTCACTCTCCCACCTCAGGG + Intronic
1076414293 10:130274274-130274296 TCCTTGCCTTTCCAGCCTCTGGG + Intergenic
1076760803 10:132605101-132605123 CCCTTCCCACTCCCTCCTCAGGG - Intronic
1077152122 11:1077164-1077186 TCCTCTCCACTCCCTCCTCGGGG - Intergenic
1078780622 11:14435673-14435695 TCCTTTCCCCAACCGCCTCCTGG - Intergenic
1078864172 11:15281396-15281418 TGTTTTCCTCTCACTCCTCAGGG - Intergenic
1079562394 11:21838642-21838664 TCCCTCCCTCTCCAGTCTCAAGG - Intergenic
1081176239 11:39930814-39930836 TCCTTCCCTCTCATGCCTCCTGG - Intergenic
1081761001 11:45576421-45576443 TCCCTGCCTCACCAGCCTCATGG - Intergenic
1083765164 11:64838161-64838183 TCCTTCCCTCTCCCTCTGCAGGG - Exonic
1084014760 11:66371827-66371849 TCCTTCCCCCACCCGCCTCAGGG + Intronic
1084765414 11:71305225-71305247 TCCTTGCCTCTCCCAGCTCCTGG - Intergenic
1084938887 11:72601793-72601815 TTCTCTCCTCTCCAGCCCCAAGG + Intronic
1086403872 11:86483731-86483753 TCCTTTCCTGGCCTGCCTAAAGG + Intronic
1088105820 11:106205420-106205442 TTCTTTCCTCTCCCCACTCCGGG - Intergenic
1089589939 11:119533671-119533693 TCCCTTCCTCTCCCGCTCCCTGG + Intergenic
1090080425 11:123608908-123608930 TCCTTCCCTCGGCCACCTCAGGG + Intronic
1090493772 11:127190165-127190187 TCATCACCTCTCCCTCCTCAAGG - Intergenic
1090727775 11:129543228-129543250 TCCTTTCCTCTTCCAGCTCTGGG - Intergenic
1090942879 11:131403918-131403940 GCCTCTCCTCTCTCCCCTCAAGG + Intronic
1091010045 11:131992832-131992854 ACCATTCCTCTCCAGTCTCATGG - Intronic
1091833035 12:3563667-3563689 TCCTTTCCTCACCCGGCAAATGG - Intronic
1092288368 12:7143105-7143127 TCCCTTCCTCTGCCACCTCCTGG + Intronic
1092724166 12:11468703-11468725 TCCTTGCCTCTCCCAGCTCCTGG + Intronic
1093573245 12:20693769-20693791 TCCTTACCTCTTCCACCTCCTGG - Intergenic
1095533648 12:43221074-43221096 TCCTTTCTTTTCCTGCCTAAGGG + Intergenic
1095721480 12:45406075-45406097 TTCCTTCCTCTCCCGCCTTTGGG + Intronic
1095844478 12:46730619-46730641 ACCTTTACTGTCCTGCCTCAGGG - Intergenic
1096499305 12:52055505-52055527 GCCTGTCCTCTCCCAACTCAAGG + Intronic
1097052174 12:56230219-56230241 TTGTTTCCTCTCCCCCCGCAGGG + Intronic
1097471401 12:59997606-59997628 TTCCTTCCTCTCCCTCCTGAAGG + Intergenic
1097697190 12:62786322-62786344 TCCTTTCCTCTCCCGCCTCAGGG - Intronic
1097702973 12:62839031-62839053 TCCTTTCTTCTCCCTGGTCATGG - Intronic
1097865454 12:64556164-64556186 TCCTTTCCACTCCCCACTCAAGG - Intergenic
1097921847 12:65084314-65084336 TCCTTTCCTGTCCCTGCTTATGG + Intronic
1098595707 12:72272057-72272079 TCCTTTTCTCTCCAGCTGCAGGG + Intronic
1098778650 12:74654976-74654998 GCCTTTCATCTCCTGCCACAAGG - Intergenic
1099243322 12:80164240-80164262 TCCTTTCCTCTTCTCCTTCAAGG + Intergenic
1099502911 12:83435720-83435742 TCATTCCCTCTACCGCCTCCTGG + Intergenic
1100743453 12:97620180-97620202 ACCTTTCCCCTCTCGCTTCATGG - Intergenic
1101599693 12:106198197-106198219 TGCTTCCCTTTCCCACCTCATGG - Intergenic
1107699910 13:43036904-43036926 GCCTGGCCTCTCCCGACTCACGG - Intronic
1108582833 13:51841188-51841210 TCCTTTCCTCACCCTTCTTAGGG + Intergenic
1108599202 13:51975847-51975869 GCCTTTCCCCTCCCGCCCCTCGG - Intronic
1110239829 13:73254789-73254811 GGCTTTCCTCTCCAGCCTCCTGG + Intergenic
1112484729 13:99810192-99810214 TCCTCTCCTCTCCGGGCTTATGG + Intronic
1112946329 13:104931178-104931200 ACCTTTTCTCTCCTTCCTCAGGG + Intergenic
1113893152 13:113747234-113747256 TCCTTTCATCTCGGGGCTCATGG + Intergenic
1114049612 14:18912670-18912692 TCCTTTTCTCTCCTGCCTTGGGG - Intergenic
1114081312 14:19203450-19203472 TTCTTTCCTCTTAGGCCTCAAGG - Intergenic
1114112950 14:19489261-19489283 TCCTTTTCTCTCCTGCCTTGGGG + Intergenic
1114425135 14:22615189-22615211 TCCTTTTCTGTCCTTCCTCAGGG + Intergenic
1114538994 14:23440998-23441020 TCCTCTTCTCTCCAACCTCATGG - Intergenic
1115495724 14:34002470-34002492 TCCTTTCCTTTTCCGCCTTTTGG - Intronic
1115768349 14:36646755-36646777 TCATCTCCACTCCGGCCTCAGGG - Intergenic
1115816763 14:37172117-37172139 TCCTCTGCTCTCGCGCCTCTAGG + Intronic
1117383527 14:55189248-55189270 TCATTTCCTGTCCCACTTCAGGG + Intronic
1118051864 14:62038056-62038078 TCTTTTCCTATCCTGCCTCCAGG + Intronic
1118321113 14:64753907-64753929 TCCTTTCTACTCCCACCTCCTGG + Intronic
1119592274 14:75900716-75900738 CTCTTTCCTCTCCCTCCTCCTGG + Intronic
1119678659 14:76575459-76575481 TCCTTGCCTCTCCCGGCTTCCGG + Intergenic
1119688934 14:76655341-76655363 CCTTTTCCTCTCCCTCCTCCTGG + Intergenic
1119780005 14:77271089-77271111 GCCTTTTCTCTCCCGCGCCAGGG - Exonic
1124168818 15:27353897-27353919 TCATTGCCTCTCCCACCCCATGG + Intronic
1124379920 15:29156603-29156625 TCCTCTCCGGTACCGCCTCACGG - Intronic
1124847810 15:33309381-33309403 TCTTTTCTTCTCCTGGCTCAAGG - Intergenic
1125198560 15:37077186-37077208 TCCTTTCCTCACACGGATCAGGG - Intronic
1126710063 15:51445226-51445248 TCCTTTACCCTCCTCCCTCACGG + Intergenic
1127170371 15:56294313-56294335 TCCTTTCCTTTCCTGCATCAGGG + Intronic
1129660063 15:77548466-77548488 GCCTCTCCTCTCCCGTCTGAGGG - Intergenic
1130220038 15:82011624-82011646 TCCTTGCCTCTTCCACCTTATGG - Intergenic
1130283887 15:82540131-82540153 TCCTGTCCTCTCCACCCGCAGGG - Exonic
1131408485 15:92186005-92186027 TCCTTCCCTCTCTCATCTCAGGG + Intergenic
1131710634 15:95051994-95052016 TCCTTTTCTCTGCAGCCTCCTGG + Intergenic
1131775852 15:95797740-95797762 TCATTTCCTATCCGGCCTCCAGG + Intergenic
1132590179 16:723160-723182 TCCTTTCCTCTCCCCTCACAGGG - Exonic
1133277972 16:4649438-4649460 TCCTTACCTCTCCCCACTCCTGG + Intronic
1133341672 16:5040604-5040626 TCCTTCCGGCTCCCGGCTCAAGG - Intronic
1133460764 16:5984213-5984235 TCTCTTCCTCTTCCTCCTCATGG + Intergenic
1133689812 16:8202499-8202521 TCCTTGCCTCTCCCCGCTCCTGG + Intergenic
1134136200 16:11677914-11677936 TCCCTACTTCTCCCGCCTCGGGG - Exonic
1134912839 16:18043771-18043793 TCCTTCTCTCTCCCGCTTCCTGG + Intergenic
1135415921 16:22267844-22267866 TCCTTTCCTCCCTCTGCTCACGG - Intronic
1137322636 16:47400780-47400802 TCCTTTGTGCTCCCGCCACATGG - Intronic
1138455167 16:57116831-57116853 TCCTCTCCTCTCCTGCCTCTAGG - Intronic
1138608001 16:58100951-58100973 TCTTTTCCTCTCCTTGCTCAAGG + Intergenic
1139275460 16:65723702-65723724 TCCTTACCTCTCCGGACTCCAGG - Intergenic
1140638197 16:76941435-76941457 TCTTTTCCTCTTGCCCCTCAGGG + Intergenic
1140885133 16:79236324-79236346 TCCCTCCCTCTCCCTCCTCCAGG + Intergenic
1141177969 16:81733123-81733145 TCTTTTTCTCTCCCTGCTCATGG + Intergenic
1141277049 16:82597690-82597712 TCCTTTCCTTTCCCACCTTCTGG - Intergenic
1143118680 17:4594519-4594541 TCCTGTCCTCTCCCTCCTGCCGG - Intronic
1143859723 17:9879923-9879945 TCATTTTCTCTCCCTTCTCATGG + Intronic
1144244232 17:13347113-13347135 TCCTTTCCTTTCCTGCCTCGTGG - Intergenic
1144601709 17:16620998-16621020 TCCTTTTCTCACTCCCCTCAAGG + Exonic
1146668033 17:34717649-34717671 TCCTGTCCCCTCCCGCCCCAGGG + Intergenic
1146890227 17:36501995-36502017 TCCTTTCTTCTCCCTCTCCATGG - Intronic
1147258825 17:39197159-39197181 TCCTTATCTCCCCCGCGTCAAGG - Intronic
1147312015 17:39601082-39601104 TCCTTCCCTTTCCCGCCAGATGG + Intergenic
1147945467 17:44077942-44077964 TCCTCCCTTCTCCAGCCTCAGGG - Exonic
1147953408 17:44119501-44119523 TCCCTTCCTCTTCTGCCTCAGGG - Intronic
1150448399 17:65245361-65245383 TCCTTACCTCTTCAGCCCCATGG - Intergenic
1150491478 17:65577290-65577312 TCCTTTCCTGTCCCCTCTGACGG - Intronic
1151364281 17:73607010-73607032 CCCTTGCCTGTCCAGCCTCATGG - Intronic
1151464825 17:74277678-74277700 ACCTACCCTCTCCCGCCTCCAGG - Intronic
1151811111 17:76442600-76442622 TCCCTTCCTCTCATGCCCCATGG - Intronic
1152785441 17:82245647-82245669 GCCTTGCCACTCCTGCCTCACGG + Intronic
1154499113 18:14985762-14985784 TTCTTTCCTCTTAGGCCTCAAGG + Intergenic
1156990393 18:43401460-43401482 ACCTTTACTCTCCTACCTCAGGG - Intergenic
1157550827 18:48580797-48580819 TGGTTTCCACTCCCACCTCAAGG + Intronic
1158264993 18:55651969-55651991 ACCTTTCCTCTCCAGTCTTAAGG - Intronic
1158624805 18:59061859-59061881 ACCTTTCCTCTCCCGCAGCCAGG + Intergenic
1160148205 18:76380931-76380953 GCCTTTGCTCACCCGCCTCTGGG - Intronic
1160276597 18:77443178-77443200 TCCCTTGCTGTCCCTCCTCAGGG + Intergenic
1160615748 18:80126412-80126434 TCATTTCCTCTGCCTCCTGAAGG + Intronic
1160780816 19:877227-877249 CCCATTCCTCTCCCGGCTGAGGG - Intronic
1161099628 19:2415309-2415331 TCCTTTTCTCAGCCGCCCCATGG + Intronic
1161638434 19:5404195-5404217 TCCTTTCCTCTCCTGGCACCAGG + Intergenic
1161858263 19:6778291-6778313 TTCTTTCCTCTCCAGTCTCTTGG - Intronic
1162138767 19:8572619-8572641 GCCTTTCCTGTCCATCCTCATGG + Intronic
1162480706 19:10925435-10925457 TCATTCCCTCACCCTCCTCAGGG + Intronic
1163327611 19:16615198-16615220 TCCTTGCCTCTCTGGTCTCAGGG - Intronic
1163767347 19:19170911-19170933 TCCTTACCTCTCCCCGCTAAAGG + Intronic
1164939744 19:32243403-32243425 GCCTTTCCTCTCCCCTCTCCAGG + Intergenic
1165800016 19:38543673-38543695 CCCTTCCCACTCCCGCCCCAGGG - Intronic
1166822276 19:45587838-45587860 TCCTCTCCTCTTCCTCCTTACGG - Intronic
1167085535 19:47307229-47307251 TCCTTGCCTCTCCCACCTTCAGG - Intronic
1167433550 19:49466165-49466187 TCCCTGCCTCTCCAGCCTCGAGG - Exonic
1167605925 19:50481230-50481252 TCCCTTCCTCTCCAGCCTCATGG - Intronic
1168103050 19:54151293-54151315 TCCTGTCCTCACCAGCCCCAGGG - Intronic
926583321 2:14656288-14656310 TCCTGTTCTCTCCACCCTCAGGG - Intergenic
927053569 2:19351263-19351285 TACTTTTCTCCTCCGCCTCAGGG - Intergenic
928318240 2:30262685-30262707 TCCTTGCCTTTCCCCTCTCAAGG - Intronic
928360258 2:30656860-30656882 TCCTTTGCTGTCCCTCCACAGGG - Intergenic
928364587 2:30691383-30691405 TCCTTTGCTCCTCCCCCTCAGGG - Intergenic
929778283 2:44942003-44942025 CCCTCTCCTCTCCCTCCTCCTGG + Exonic
930154232 2:48089373-48089395 TCCCTTCCTCTCCTCCCTAATGG - Intergenic
930536690 2:52652938-52652960 ACCTTTACTGTCCTGCCTCAGGG - Intergenic
930910071 2:56620224-56620246 ACCTTTACTCTCCTACCTCAGGG + Intergenic
932103738 2:68924333-68924355 TCCTTTCCTCACCCACATCAGGG + Intergenic
935579386 2:104743693-104743715 GCCTTTTCTCTCCCTCCTCTGGG - Intergenic
935650044 2:105374267-105374289 TCCCTTCCTCCCCCAGCTCACGG - Intronic
935814201 2:106831253-106831275 TCCTTTACCCTCCCTCCTCTTGG + Intronic
936440475 2:112547552-112547574 TCATTACCTCTGCCTCCTCATGG - Exonic
936855433 2:116952483-116952505 TCTTTTCCTCACCCACCACAAGG + Intergenic
937046780 2:118855958-118855980 CCGTTGTCTCTCCCGCCTCAGGG - Intergenic
937759528 2:125583914-125583936 TCTTTTTCTCTCCCACCTCTAGG + Intergenic
937975266 2:127578314-127578336 CCCTTCCCTCTCCCTCCCCAAGG - Intronic
938288620 2:130137883-130137905 TCCTTTTCTCTCCTGCCTTGGGG + Intergenic
938426969 2:131201004-131201026 TCCTTTTCTCTCCTGCCTTGGGG - Intronic
938498084 2:131813871-131813893 TTCTTTCCTCTTAGGCCTCAAGG + Intergenic
941667924 2:168260454-168260476 ACCTTTACTCTCCTACCTCAGGG + Intergenic
941697827 2:168572273-168572295 TTCTTTCCCCTCCCTTCTCAGGG - Intronic
943771999 2:191728016-191728038 ACCTTTCCTCTCCCATCACAAGG - Intergenic
945347689 2:208738486-208738508 TCCTTTTCTCCCCCTCCTGATGG + Intronic
945681959 2:212925001-212925023 GCCTTTCCTCTTCCTGCTCATGG + Intergenic
947531143 2:230909277-230909299 TCCTTTCCTCTCCCCCCTCATGG + Exonic
947650278 2:231780933-231780955 TCCTTTCCTCTCCCCTCCCGCGG + Intronic
947875659 2:233466622-233466644 TCCTCTGCTCTTCTGCCTCAGGG + Intronic
948135202 2:235631395-235631417 TCCTTGGCTCTCCCGCCTCGTGG - Intronic
948139344 2:235661317-235661339 TGTTTTCCTCTGCCGCCTGAAGG + Intronic
948610101 2:239161638-239161660 TCCTTCCCCCTCCAGCCTGAAGG + Intronic
1169781318 20:9313910-9313932 TCCTCTCCTCTCACACCACAAGG - Intronic
1170260922 20:14407289-14407311 TCCTTTCCTCTCCCTCCCCCTGG + Intronic
1170570937 20:17632253-17632275 TCCTGTCCTCTCCAGACTCAGGG - Intronic
1171146666 20:22790115-22790137 TGCTTTCCTGTCTCACCTCAGGG - Intergenic
1171271522 20:23822060-23822082 TCATTTCCTCTCCACCCCCAAGG - Intergenic
1172133650 20:32673108-32673130 TCCTCTCCTCACCCGCCCCAGGG - Intergenic
1173160509 20:40648689-40648711 TCCTGTCCTCTCCCTGCTGATGG + Intergenic
1174728336 20:52888857-52888879 ACCTTTCTTCTCCAGCCACAGGG - Intergenic
1174872882 20:54199876-54199898 TTCTTGCCTCTCACTCCTCATGG + Intergenic
1175281510 20:57807016-57807038 TTCCTTCATCTCCCACCTCAGGG + Intergenic
1175350526 20:58314953-58314975 TCCCTTGCCCTCCCGCCTCACGG - Intronic
1175545711 20:59776487-59776509 TCCTGTCCTCACCAGCCACACGG + Intronic
1177585224 21:23084450-23084472 TCTCTTCCTCTCCCTCCTCTGGG - Intergenic
1177828181 21:26107040-26107062 TCCTTTCCCCGCCACCCTCAGGG - Intronic
1178748907 21:35281923-35281945 TCCTTTCCTCTTCCAGCTCCTGG - Intronic
1179719317 21:43306433-43306455 TCCTTTCCTTTCCCTCCTCCAGG + Intergenic
1180206730 21:46265505-46265527 TCCTCTCCTCTCCCTCCGCCTGG + Exonic
1180468091 22:15635045-15635067 TCCTTTTCTCTCCTGCCTTGGGG - Intergenic
1180997827 22:19974183-19974205 TCTCTACCTCTCCCTCCTCACGG - Exonic
1182535970 22:31003153-31003175 TCTTTTCCTCTCCCAGCCCATGG - Intergenic
1183384051 22:37504769-37504791 TCCTCTCCTCTCCCTCTTCCAGG - Exonic
1183583466 22:38738987-38739009 TGCCTTCCTCTCCTGTCTCAGGG - Exonic
1183678576 22:39313540-39313562 TCCTTTCCTCTCCCACCACAGGG + Intronic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
949388987 3:3537828-3537850 TCCTTTTTTCTCCCCACTCATGG + Intergenic
949638693 3:6011857-6011879 ACCTTTACTCTCCTACCTCAGGG + Intergenic
950044945 3:9943521-9943543 ACCTCCCCTCTCCCGCCCCAGGG - Intronic
950600945 3:14035188-14035210 TCCCTTGCTCTGCCGCCTCCAGG - Intronic
952604254 3:35125165-35125187 TCCCTTCCTCTCCATCCCCATGG + Intergenic
952606639 3:35155034-35155056 TCCCTTCCTCTGCTGCCTCCAGG + Intergenic
952799566 3:37275992-37276014 TACTTTCTTCTCTTGCCTCAGGG - Intronic
953123520 3:40069590-40069612 TCCTTTCCTCCCCCAGCTCCTGG + Intronic
953608048 3:44424637-44424659 TCCTCTCCTCACCTGCCTGATGG + Intergenic
954139199 3:48596183-48596205 TCCTTTCCTCACTGCCCTCATGG + Intergenic
954415464 3:50391251-50391273 TCCATTCCACTCCCAGCTCATGG + Intronic
955138151 3:56240970-56240992 TCCTTTCCTCTCCCCCATTTTGG + Intronic
959431075 3:106256181-106256203 TCCTTTCCCCACCCGCCCCCCGG + Intergenic
959783364 3:110263896-110263918 TCTTTTCCTTACCCGTCTCAAGG + Intergenic
960068109 3:113397351-113397373 TCTCTTCCTCTCCAGCCTCCTGG - Intronic
960537070 3:118826273-118826295 CCCTTTTCTCTCCCTCCTTATGG + Intergenic
960971458 3:123142903-123142925 TCCTTTCATCTGCCACCTCCAGG + Intronic
961037032 3:123649440-123649462 TCCCATCCTCTCTAGCCTCATGG + Intronic
961579792 3:127871354-127871376 TCCTTTCCTCTTCCGATCCATGG + Intergenic
962242163 3:133758935-133758957 AACTTTCCTCTCCAGCCTCTGGG - Intronic
962760589 3:138509542-138509564 ATCTTTCTTCTCCCTCCTCATGG + Intronic
965452025 3:168849899-168849921 TCCTTTACTTTCCTTCCTCATGG + Intergenic
966925928 3:184644549-184644571 CCCTTGCCTCTCCCTCCCCACGG + Intronic
966982665 3:185152820-185152842 TCATTTCCTCTCCCTCCGCGCGG + Exonic
967969820 3:194990756-194990778 TCCTTTCCTCTCCCGGCCCTGGG + Intergenic
968087265 3:195879396-195879418 TCCTTTCCTCTTCCCCCACCAGG - Intronic
968624357 4:1619868-1619890 AGCTGTCCTCTCTCGCCTCATGG + Intronic
970276839 4:14409835-14409857 TCTTTTTCTCTGCAGCCTCATGG - Intergenic
970447957 4:16139774-16139796 TCTCTTCATCTCCCGCCCCAGGG - Intergenic
970538154 4:17051137-17051159 TCCTCTTCTCTCTCCCCTCATGG - Intergenic
971026066 4:22589303-22589325 TCCTTTTCTCTCCTGGATCATGG - Intergenic
971501172 4:27319299-27319321 GCCTTTCCTCTCTAGACTCAAGG + Intergenic
972095420 4:35342006-35342028 ACCTTTGCTCTCCTACCTCAGGG + Intergenic
974289489 4:59912077-59912099 ACCTTTCATGTCCTGCCTCAGGG + Intergenic
975526272 4:75353857-75353879 TCCTTTCCTCTCCCAGCTTCTGG - Intergenic
977845589 4:101763121-101763143 TCTTTTCCTCTCTCCCCTCTTGG - Intronic
978377191 4:108087089-108087111 TCTTTTTCTCTCCTGCCTTAGGG - Intronic
979685895 4:123510039-123510061 ACCTCTACTCTCCTGCCTCAGGG + Intergenic
979813043 4:125064254-125064276 TGCTTCCCTCTCCTGCCTCAGGG - Intergenic
980006647 4:127550362-127550384 TCTTTTCCTCTCCCACCTAGGGG - Intergenic
981492024 4:145349494-145349516 CCCTTTCTTCTTCCTCCTCAAGG - Intergenic
982203064 4:152976729-152976751 GCCTGTCCTCTCCTGCCTCCTGG + Exonic
985170177 4:187140242-187140264 TCCTTGCCTTTCCAGCCTCTAGG - Intergenic
986702247 5:10421887-10421909 TAATTTCCTCTGCAGCCTCAAGG - Intronic
989618727 5:43363837-43363859 TCCTCTCCTCTCCCCCTTTATGG - Intergenic
990994688 5:61719803-61719825 TCATCTCCTCTTCCTCCTCATGG - Intronic
991590525 5:68246924-68246946 GCCTTTCCTCTCCCCTCTTAAGG - Intronic
992086043 5:73279229-73279251 TCCCTTCCTCCCCCACCCCATGG + Intergenic
995602278 5:113810574-113810596 TCCTTGCCTCTCCCAGCTTATGG - Intergenic
995960829 5:117836898-117836920 TCCTATTCTCTCCTGCTTCAGGG - Intergenic
996590968 5:125147429-125147451 TCCCTTCCTCCCCGGCCACAGGG + Intergenic
997528941 5:134570512-134570534 TCCTTTCCTGTCATCCCTCATGG + Intronic
998105075 5:139463121-139463143 CACATTCCTCTCCCTCCTCAGGG + Intergenic
998394902 5:141812121-141812143 TCTTATCCTCTCCCACCGCAGGG - Intergenic
998503468 5:142653370-142653392 TCCTTTCCTCTTCTGCCTGAAGG - Intronic
998573312 5:143285191-143285213 TTCTTTCCTCTATGGCCTCAAGG - Intronic
998985305 5:147750382-147750404 TCCTTTGTTCTCCAGTCTCATGG + Intronic
999094462 5:148965635-148965657 TCTTTACCTCTCCAGCCCCATGG - Intronic
999341692 5:150778789-150778811 TCCTGCGCTCTCCCGCCTCCCGG + Exonic
999508089 5:152219081-152219103 TCCTCTCCCCTCCCACCTCTGGG - Intergenic
1003285831 6:4733138-4733160 TGCTTTCCTCTCCTTCCCCAGGG + Intronic
1003486556 6:6585097-6585119 TCCTCTCCTCTCTCCCCTCCAGG + Intergenic
1005147437 6:22707568-22707590 GCCTTTCCTCTCTTGCCCCAGGG + Intergenic
1005743590 6:28815341-28815363 TCATTTTCTCTCCACCCTCAGGG - Intergenic
1005972579 6:30773021-30773043 TCCTCTCCTCTCCCACCTCTGGG + Intergenic
1006440852 6:34052745-34052767 TCCTTCCCTCTCACTCCTCCAGG - Intronic
1006478539 6:34273555-34273577 TCCTTTGCCCTCCAGACTCAAGG + Intergenic
1006871194 6:37253828-37253850 TCCTTTTCTCTCCCTACTCAAGG + Intronic
1007227427 6:40324983-40325005 TCCTTCCCTCTCCCCCACCAGGG + Intergenic
1007269776 6:40627719-40627741 TTCCTTCCCCTCCCTCCTCATGG + Intergenic
1007634281 6:43288374-43288396 TCATTTCCTCCCCTGCCTCCAGG - Intergenic
1009852014 6:69209633-69209655 TCCTTTACTGTCCTACCTCAGGG - Intronic
1010612542 6:77971689-77971711 TCCTTTTCTCTGCAGCCTTATGG - Intergenic
1011725057 6:90202742-90202764 TCCTTTACTCTTCTCCCTCATGG - Intronic
1015355338 6:132271300-132271322 TCCTTTCCTTTCCCTTTTCAAGG + Intergenic
1016811401 6:148264657-148264679 ACCTTTTTTCTCCCACCTCAGGG + Intergenic
1017526206 6:155243306-155243328 TCCTGGCCTCTTCTGCCTCAGGG - Intronic
1017535928 6:155348452-155348474 TCCCTTCCTCTGCTGCCTCCAGG - Intergenic
1017872870 6:158501983-158502005 TCCCTGCCTCCCCCGCCGCAGGG + Exonic
1018639319 6:165892065-165892087 TTCCTTCTTCACCCGCCTCATGG - Intronic
1018741715 6:166734116-166734138 AACTTTCCTCTCTCCCCTCAGGG - Intronic
1018788520 6:167128065-167128087 TCTTTTCTTCTCCCGTCTCCAGG + Intronic
1018870239 6:167777104-167777126 CCCTTTGCTCTCCAGCCTTAGGG - Intergenic
1019798827 7:3072791-3072813 GTCTTTCCTCTTCTGCCTCAGGG - Intergenic
1021729779 7:23585112-23585134 TCCTTTCTTCTCCCGCCTTTGGG - Intergenic
1021964634 7:25905540-25905562 TCCTTTCTGCTCCCACCTTAGGG - Intergenic
1022945814 7:35282414-35282436 TCCTTTCCTCTCTTTCGTCACGG - Intergenic
1023133746 7:37030070-37030092 TACTTTCCTCTCCAGCTTCTTGG + Intronic
1023427693 7:40056450-40056472 ACATTTGCTCACCCGCCTCAGGG + Intronic
1023794495 7:43780573-43780595 TGCTTTCCTCACCCTCCTCTAGG + Intronic
1023869639 7:44256123-44256145 GCCTCTCCTCTCACTCCTCATGG + Intronic
1026882491 7:73916397-73916419 TCCCCTCCTCTCCAGCTTCATGG + Intergenic
1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG + Intronic
1028237736 7:88382157-88382179 ACCTTTACTCTCCTACCTCAGGG + Intergenic
1031317517 7:120274721-120274743 CCTTTTCCTCTCCTGCCTCGGGG - Exonic
1032805146 7:135346803-135346825 TCTTTTCCTCTCTGTCCTCATGG + Intergenic
1033685693 7:143639639-143639661 GCCTTTTCTCTCCCGCCTTGTGG + Intronic
1033690050 7:143727676-143727698 GCCTTTTCTCTCCCGCCTTGTGG - Intronic
1033698921 7:143817982-143818004 GCCTTTTCTCTCCCGCCTTGTGG - Intergenic
1034426863 7:151018522-151018544 TCCTTACCTCTCCCACCACTGGG - Intronic
1035913077 8:3590359-3590381 TCCTTTCTTCTCACCCATCAAGG + Intronic
1036772665 8:11589762-11589784 TCCCTTCTTCTCCCTCCTCATGG - Intergenic
1037348332 8:17923235-17923257 GCCGTTACTCTCCCGCCTCTGGG - Intronic
1037776043 8:21836283-21836305 TCCTTGCCTCTCCCAGCTCCTGG + Intergenic
1038401648 8:27288536-27288558 TCATTTCCTCTTCCGTCTCCTGG - Intronic
1038546156 8:28427090-28427112 CCCTTTGCTCTCCAGCCTAAGGG + Intronic
1038631751 8:29251987-29252009 TTCTTTCCTTTCCTGGCTCATGG - Intronic
1038996395 8:32927919-32927941 CCCTTTCTTCTCCCGCCTACTGG - Intergenic
1039330547 8:36532390-36532412 ACCTTTCCTGTCCTACCTCAGGG + Intergenic
1039429254 8:37512781-37512803 ACCTTTGCTCTCCTGCCTCCTGG + Intergenic
1039846319 8:41328200-41328222 CACTTTGCTCTCCCGCCTCCGGG + Intergenic
1040554380 8:48466301-48466323 TCCTCTCTTCGCCCTCCTCATGG + Intergenic
1040723360 8:50351956-50351978 CCTTTTCCTCTCCTCCCTCAAGG - Intronic
1041056733 8:53993666-53993688 ACCTTTCTTCTCTTGCCTCAGGG + Exonic
1042796626 8:72670588-72670610 CCATTTCCTCTCCCTACTCAAGG + Intronic
1043408711 8:79968656-79968678 TCTTCTCCTCTCTCGCCTTAGGG + Intronic
1043418042 8:80071594-80071616 TCCATTCCTCTCCTCCCTCCTGG + Intronic
1043500468 8:80849376-80849398 ACCTTTCCCCACCCTCCTCACGG + Intronic
1045037717 8:98189027-98189049 TCCCTTTCTCACCAGCCTCAGGG - Intergenic
1045094748 8:98785544-98785566 TCTTTCCCTCTGCCCCCTCAGGG + Intronic
1046970969 8:120223076-120223098 TCCTTGCCTTTCCCACCTCAGGG - Intronic
1047230829 8:122996459-122996481 TCCTTTGCTCTCCCATCACAGGG + Intergenic
1047603453 8:126450568-126450590 TGCTGTCTTCTCCAGCCTCATGG + Intergenic
1047623890 8:126635912-126635934 TGCTTTCTTCTCCAACCTCAAGG - Intergenic
1048300497 8:133247768-133247790 TCCTCTCCTCTGCCCCATCAGGG - Intronic
1049122855 8:140755454-140755476 TACTGTCCTGCCCCGCCTCATGG + Intronic
1050905251 9:10994843-10994865 GCCTTTCCTCTCCCACCATATGG + Intergenic
1052044229 9:23775827-23775849 ACCTTTCTTCTCCTGCCTCATGG + Intronic
1052325758 9:27215288-27215310 CCCTTTCCTCCCCAGCCCCAAGG - Intronic
1053184859 9:36007164-36007186 TCTTTTTCTCTTCAGCCTCAAGG + Intergenic
1053597051 9:39573453-39573475 TCTTTTCTTCACCCGCCACAAGG + Intergenic
1053855081 9:42330436-42330458 TCTTTTCTTCACCCGCCACAAGG + Intergenic
1054569205 9:66791544-66791566 TCTTTTCTTCACCCGCCACAAGG - Intergenic
1056042233 9:82680336-82680358 AGCTGTCCTCTCCCACCTCAGGG + Intergenic
1056806425 9:89732494-89732516 TCCTTTCCTGTCATGACTCAGGG + Intergenic
1057491141 9:95520752-95520774 TCCATTCATCTCCTCCCTCACGG + Intergenic
1057726196 9:97570276-97570298 TCCATGCCTTTCCCTCCTCATGG + Intronic
1058438033 9:104981915-104981937 TGCTTGCCTCACCCGCCTCTTGG + Intergenic
1059409209 9:114121645-114121667 ACCTTTCCTCTCCCAGCCCAAGG - Intergenic
1059438647 9:114290551-114290573 TCCTTTCCTCCCCTGCCTGGTGG + Intronic
1059984622 9:119809961-119809983 TTCTATCCTCTCCCCCATCATGG + Intergenic
1060234431 9:121852584-121852606 TCCTATTCTCTCCACCCTCAAGG + Intronic
1060246722 9:121952708-121952730 CCCCTTCCTCTCCTTCCTCATGG + Intronic
1060828373 9:126699210-126699232 TCTTTCCCTCTCTTGCCTCAGGG - Exonic
1061206562 9:129167220-129167242 TTCCTTCCTCTCCCGGGTCAGGG - Intergenic
1061502217 9:131010410-131010432 TCCCTGCCTCTCCCGCCCCACGG - Intronic
1185599520 X:1329368-1329390 TTCCTGCCTCTCCCGCCTCCTGG - Intergenic
1186515585 X:10164261-10164283 TCCTGTCCTGCCCTGCCTCAGGG - Intronic
1186629215 X:11330853-11330875 TCCTTTCCTCTCTATTCTCATGG + Intronic
1187126311 X:16457590-16457612 TCCTTTCCTCCTCCTCCTCTTGG - Intergenic
1187639346 X:21271535-21271557 TCTTTTTCTCTCCCACCTCTGGG - Intergenic
1191156846 X:57283479-57283501 TCATTTCTTCTCCAGCCTGAGGG + Intergenic
1192216754 X:69164669-69164691 TCCTTGCCCCTCCATCCTCAAGG - Intronic
1193053404 X:77125091-77125113 ACCTTTACTGTCCCACCTCAGGG + Intergenic
1193649339 X:84110390-84110412 CCCTTTCCCCTCACCCCTCATGG + Intronic
1194248697 X:91545781-91545803 TCCTCTCCTCTTCCATCTCATGG + Intergenic
1194441202 X:93936908-93936930 TCTCTCCCTCTCCCGCCTCCTGG + Intergenic
1194833864 X:98658125-98658147 ACCTTTACTGTCCCACCTCAGGG + Intergenic
1195083260 X:101390630-101390652 TCCATTCCTGTTCCACCTCAAGG - Intronic
1195778830 X:108438427-108438449 TTCTTTCCTCTCCTGCTGCATGG - Intronic
1196406511 X:115368051-115368073 TCCTTTCCTGTCCTGCCAGAGGG + Intergenic
1197115989 X:122834435-122834457 TCCTTTCCTTTCCAGGTTCATGG - Intergenic
1199612432 X:149630098-149630120 TCCCTTCCTCTGCTGCATCAGGG - Intronic
1199812616 X:151365728-151365750 TCCTTTCCACTGCAGCCTCCAGG + Intergenic
1200165382 X:154031814-154031836 TCCTTTGCTCACCCTTCTCATGG + Intronic
1200298868 X:154952161-154952183 CCCTCTTCTCTCCAGCCTCATGG - Intronic
1200567703 Y:4787300-4787322 TCCTCTCCTCTTCCATCTCATGG + Intergenic
1202359675 Y:24094715-24094737 ACCTTTACTCTCCTACCTCAGGG + Intergenic
1202511103 Y:25575399-25575421 ACCTTTACTCTCCTACCTCAGGG - Intergenic