ID: 1097697879

View in Genome Browser
Species Human (GRCh38)
Location 12:62792057-62792079
Sequence CCGTGGACGGCCCTGTTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 28}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097697879_1097697888 27 Left 1097697879 12:62792057-62792079 CCACGTAACAGGGCCGTCCACGG 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1097697888 12:62792107-62792129 GCAAGTTCGGGCTACACCACAGG 0: 1
1: 0
2: 0
3: 1
4: 42
1097697879_1097697886 14 Left 1097697879 12:62792057-62792079 CCACGTAACAGGGCCGTCCACGG 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1097697886 12:62792094-62792116 GGGACTCAGTTAAGCAAGTTCGG 0: 1
1: 0
2: 0
3: 13
4: 80
1097697879_1097697882 -7 Left 1097697879 12:62792057-62792079 CCACGTAACAGGGCCGTCCACGG 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1097697882 12:62792073-62792095 TCCACGGCAACAAATTCCTTTGG 0: 1
1: 0
2: 0
3: 6
4: 70
1097697879_1097697887 15 Left 1097697879 12:62792057-62792079 CCACGTAACAGGGCCGTCCACGG 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1097697887 12:62792095-62792117 GGACTCAGTTAAGCAAGTTCGGG 0: 1
1: 0
2: 0
3: 14
4: 96
1097697879_1097697884 -6 Left 1097697879 12:62792057-62792079 CCACGTAACAGGGCCGTCCACGG 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1097697884 12:62792074-62792096 CCACGGCAACAAATTCCTTTGGG 0: 1
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097697879 Original CRISPR CCGTGGACGGCCCTGTTACG TGG (reversed) Intronic
1063126976 10:3144051-3144073 CCGAGGAGGGCCCTGGTATGGGG - Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1097697879 12:62792057-62792079 CCGTGGACGGCCCTGTTACGTGG - Intronic
1101337229 12:103807422-103807444 CCCTGGACGGCCCCATTACCAGG + Intronic
1101995368 12:109521741-109521763 CCATCGACAGCCCTGTGACGGGG + Intronic
1113852824 13:113427724-113427746 CTGAGGACGGCCCGGTCACGGGG + Intronic
1114618628 14:24081792-24081814 CCGTGGCCGGCCCTGCACCGTGG - Intronic
1128931542 15:71708999-71709021 CCGTGGACTGTGCAGTTACGTGG + Intronic
1132091294 15:98949826-98949848 CCGTGGACGGTGCTGTTTTGTGG + Intronic
1151325799 17:73379256-73379278 CCGTGGACGACCACGTTACGAGG + Exonic
1158910296 18:62054392-62054414 CTGTGAAGGGCCCTGTTAAGAGG + Intronic
1161355861 19:3819321-3819343 CCGTGGCCAGCCAGGTTACGAGG + Intronic
1161428601 19:4217772-4217794 CCGTGCCCGGCCCAGTTCCGCGG - Exonic
1162719586 19:12654369-12654391 CCCTGGAAGGCCCTGGTAAGAGG - Intronic
1179241000 21:39592323-39592345 CAGTGAAAGGCCCTGTTAAGAGG + Intronic
1180099842 21:45579234-45579256 ACGTGGGCGGCCCTGGGACGGGG + Intergenic
1185041834 22:48508113-48508135 ACGTGGACAGCCCTGATGCGTGG + Intronic
950765215 3:15268406-15268428 CCCTGGACGGCGCGGGTACGGGG - Intronic
962121814 3:132569032-132569054 CTGTGAACGACCCTGTTAAGAGG + Intronic
1021024899 7:15653439-15653461 CCGTGAAAGACCCTGTTAAGAGG - Intronic
1026728753 7:72893291-72893313 CCGTGCCTGGCCATGTTACGTGG - Intronic
1026768206 7:73173792-73173814 CCGTGAACAGCCCTATAACGTGG - Intergenic
1027044672 7:74983500-74983522 CCGTGAACAGCCCTATAACGTGG - Intronic
1027078966 7:75218859-75218881 CCGTGAACAGCCCTATAACGTGG + Intergenic
1029388185 7:100257419-100257441 CCGTGAACAGCCCTGTAACGTGG + Intronic
1033477036 7:141701754-141701776 CCGGGGCCGGCCCTGGTGCGGGG + Intronic
1055357791 9:75455263-75455285 CCATGGGAGGCCCTGTTATGAGG + Intergenic
1197046547 X:122004482-122004504 CCATGGACTGCACAGTTACGTGG + Intergenic