ID: 1097699081

View in Genome Browser
Species Human (GRCh38)
Location 12:62801964-62801986
Sequence CTGTTGGCGGGCGTGTTCTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 89}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097699063_1097699081 21 Left 1097699063 12:62801920-62801942 CCCCCACCCCTCCGCGCAGGGAG 0: 1
1: 0
2: 1
3: 41
4: 413
Right 1097699081 12:62801964-62801986 CTGTTGGCGGGCGTGTTCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 89
1097699066_1097699081 19 Left 1097699066 12:62801922-62801944 CCCACCCCTCCGCGCAGGGAGGC 0: 1
1: 0
2: 0
3: 13
4: 179
Right 1097699081 12:62801964-62801986 CTGTTGGCGGGCGTGTTCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 89
1097699067_1097699081 18 Left 1097699067 12:62801923-62801945 CCACCCCTCCGCGCAGGGAGGCT 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1097699081 12:62801964-62801986 CTGTTGGCGGGCGTGTTCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 89
1097699059_1097699081 28 Left 1097699059 12:62801913-62801935 CCCGGGGCCCCCACCCCTCCGCG 0: 1
1: 0
2: 3
3: 68
4: 546
Right 1097699081 12:62801964-62801986 CTGTTGGCGGGCGTGTTCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 89
1097699076_1097699081 -7 Left 1097699076 12:62801948-62801970 CCGGGTCAGAGTCCGGCTGTTGG 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1097699081 12:62801964-62801986 CTGTTGGCGGGCGTGTTCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 89
1097699075_1097699081 -6 Left 1097699075 12:62801947-62801969 CCCGGGTCAGAGTCCGGCTGTTG 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1097699081 12:62801964-62801986 CTGTTGGCGGGCGTGTTCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 89
1097699070_1097699081 13 Left 1097699070 12:62801928-62801950 CCTCCGCGCAGGGAGGCTGCCCG 0: 1
1: 0
2: 0
3: 28
4: 164
Right 1097699081 12:62801964-62801986 CTGTTGGCGGGCGTGTTCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 89
1097699069_1097699081 14 Left 1097699069 12:62801927-62801949 CCCTCCGCGCAGGGAGGCTGCCC 0: 1
1: 0
2: 0
3: 9
4: 173
Right 1097699081 12:62801964-62801986 CTGTTGGCGGGCGTGTTCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 89
1097699060_1097699081 27 Left 1097699060 12:62801914-62801936 CCGGGGCCCCCACCCCTCCGCGC 0: 1
1: 0
2: 8
3: 76
4: 821
Right 1097699081 12:62801964-62801986 CTGTTGGCGGGCGTGTTCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 89
1097699068_1097699081 15 Left 1097699068 12:62801926-62801948 CCCCTCCGCGCAGGGAGGCTGCC 0: 1
1: 0
2: 0
3: 14
4: 180
Right 1097699081 12:62801964-62801986 CTGTTGGCGGGCGTGTTCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 89
1097699064_1097699081 20 Left 1097699064 12:62801921-62801943 CCCCACCCCTCCGCGCAGGGAGG 0: 1
1: 0
2: 1
3: 25
4: 271
Right 1097699081 12:62801964-62801986 CTGTTGGCGGGCGTGTTCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 89
1097699073_1097699081 10 Left 1097699073 12:62801931-62801953 CCGCGCAGGGAGGCTGCCCGGGT 0: 1
1: 0
2: 1
3: 14
4: 293
Right 1097699081 12:62801964-62801986 CTGTTGGCGGGCGTGTTCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097699081 Original CRISPR CTGTTGGCGGGCGTGTTCTC AGG Exonic
902409626 1:16205466-16205488 CTGTGGGCGGGCCGGGTCTCGGG - Intronic
904322935 1:29708431-29708453 CTGGTGGCTGGGGTGTTCTGGGG - Intergenic
906117888 1:43367796-43367818 CTGTGGGCGAGGGTGTTCCCGGG - Intronic
906545400 1:46616475-46616497 GGGTTGGGGGGCGTGTTTTCGGG - Intronic
907810572 1:57865666-57865688 CTGCTCGCGGCCGTGCTCTCAGG + Intronic
916787374 1:168096415-168096437 CTGTTTGTGGGTGAGTTCTCAGG - Intronic
922722103 1:227904448-227904470 CGGGTGGCGGGCATGTTCCCTGG + Intergenic
923791503 1:237115174-237115196 CTCTTGGAGGGTGTGGTCTCTGG - Intronic
1069659132 10:70112062-70112084 CTGTTGGTGTGCGTGTTCCGTGG + Exonic
1071395149 10:85215914-85215936 GTGTTGGGTGGAGTGTTCTCTGG - Intergenic
1076680360 10:132168517-132168539 CTGTTGGCCAGCGGGTGCTCAGG - Exonic
1076859856 10:133135570-133135592 CTGTTGGGGGGTCTGGTCTCTGG + Intergenic
1076859872 10:133135623-133135645 CTGTAGGCGGGTCTGGTCTCTGG + Intergenic
1076859907 10:133135706-133135728 CTGTTGGGGGGTCTGGTCTCTGG + Intergenic
1076859939 10:133135786-133135808 CTGTTGGGGGGTCTGGTCTCTGG + Intergenic
1076860082 10:133136190-133136212 CTGTGGGCGGGTCTGGTCTCTGG + Intergenic
1076860157 10:133136378-133136400 CTGTTGGGGGGTCTGGTCTCTGG + Intergenic
1076860173 10:133136431-133136453 CTGTAGGCGGGTCTGGTCTCTGG + Intergenic
1076860215 10:133136539-133136561 CTGTTGGGGGGTCTGGTCTCTGG + Intergenic
1076860232 10:133136592-133136614 CTGTGGGCGGGTCTGGTCTCTGG + Intergenic
1076860294 10:133136755-133136777 CTGTTGGGGGGTCTGGTCTCTGG + Intergenic
1076860351 10:133136916-133136938 CTGTGGGCGGGTCTGGTCTCTGG + Intergenic
1076860368 10:133136970-133136992 CTGTGGGCGGGTCTGGTCTCTGG + Intergenic
1076860378 10:133136997-133137019 CTGTTGGGGGGTCTGGTCTCTGG + Intergenic
1076860510 10:133137375-133137397 CTGTGGGCGGGTCTGGTCTCTGG + Intergenic
1076860520 10:133137402-133137424 CTGTTGGGGGGTCTGGTCTCTGG + Intergenic
1076860549 10:133137481-133137503 CTGTTGGGGGGTCTGGTCTCTGG + Intergenic
1076860566 10:133137534-133137556 CTGTGGGCGGGTCTGGTCTCTGG + Intergenic
1076860652 10:133137777-133137799 CTGTAGGCGGGTCTGGTCTCTGG + Intergenic
1076860761 10:133138074-133138096 CTGTGGGCGGGTCTGGTCTCTGG + Intergenic
1076860862 10:133138347-133138369 CTGTGGGCGGGTCTGGTCTCTGG + Intergenic
1076860906 10:133138456-133138478 CTGTGGGGGGGCCTGGTCTCTGG + Intergenic
1076860916 10:133138483-133138505 CTGTGGGCGGGTCTGGTCTCTGG + Intergenic
1076860925 10:133138510-133138532 CTGTGGGCGGGTCTGGTCTCTGG + Intergenic
1076860969 10:133138620-133138642 CTGTTGGGGGGTCTGGTCTCTGG + Intergenic
1076861001 10:133138700-133138722 CTGTTGGGGGGTCTGGTCTCTGG + Intergenic
1076861169 10:133139158-133139180 CTGTTGGGGGGTCTGGTCTCTGG + Intergenic
1076861208 10:133139265-133139287 CTGTTGGGGGGTCTGGTCTCTGG + Intergenic
1076861260 10:133139405-133139427 CTGTTGGGGGGTCTGGTCTCTGG + Intergenic
1076861282 10:133139459-133139481 CTGTGGGGGGGCCTGGTCTCTGG + Intergenic
1076861292 10:133139486-133139508 CTGTGGGCGGGTCTGGTCTCTGG + Intergenic
1083612547 11:64011034-64011056 ATGTTGGCTGGCGTGTTGGCTGG + Intronic
1083612583 11:64011196-64011218 GTGTTGGCTGGCGTGTTGGCTGG + Intronic
1084074447 11:66762242-66762264 CAGTTTGCGCGCGTGTTCTGCGG - Intronic
1087048157 11:93861771-93861793 GTGTTTGTTGGCGTGTTCTCTGG - Intergenic
1096179130 12:49541046-49541068 CTGTTGGCGGACGAGCTCACTGG - Exonic
1097699081 12:62801964-62801986 CTGTTGGCGGGCGTGTTCTCAGG + Exonic
1106054079 13:26222048-26222070 CTGTGGGCGGCCGTTCTCTCGGG + Exonic
1122541208 14:102498568-102498590 TTGTTGGTGGGAGTGGTCTCCGG + Exonic
1129744233 15:78007168-78007190 CTGATGGGGCGTGTGTTCTCTGG - Intronic
1131426141 15:92346879-92346901 CTGGTGGTGGTCGTTTTCTCTGG + Intergenic
1132719600 16:1309327-1309349 CTGCTTGCCGGCGTGTCCTCGGG + Exonic
1134029526 16:10980546-10980568 CAGTTGGCGGCCATGCTCTCTGG - Intronic
1134539710 16:15055198-15055220 CTGTTGGCAAGGGGGTTCTCAGG - Intronic
1141062104 16:80883115-80883137 CTGTTGGGGGGAATGTTATCAGG - Intergenic
1141722826 16:85766287-85766309 CTGACGGTGGGCGTGTTCCCGGG + Intergenic
1146554911 17:33815062-33815084 GTGTGGGCGAGTGTGTTCTCAGG + Intronic
1152937537 17:83149125-83149147 CAGTTGGCGGGTGTGTTTCCAGG - Intergenic
1156462653 18:37330154-37330176 CTGGTGGAGGGCGGGGTCTCTGG - Intronic
1156543269 18:37938383-37938405 CTGTTCCCGGGCTTGCTCTCTGG + Intergenic
1160849144 19:1181721-1181743 GTGCTGGCCGGCGTGTTCCCGGG + Intronic
1162582547 19:11539817-11539839 CTGGTGGGGGGCGGGTCCTCGGG + Intronic
1162805816 19:13137473-13137495 CTGTTGGCCAGCGTGTTCCTGGG - Exonic
1167460447 19:49621695-49621717 CTGTTGGCGGGGGTGATCCTTGG + Intronic
1168504251 19:56919870-56919892 CTGTTGAAGGCCTTGTTCTCCGG + Intergenic
926017726 2:9469411-9469433 CTGTTGGCGGCCCTGTTCCCTGG + Intronic
927856771 2:26532668-26532690 CTGTTGGAGGGAGTGATCTCAGG + Intronic
936248497 2:110849026-110849048 CTGTTGGAGGGTGAGTTCACTGG - Intronic
1169788587 20:9386048-9386070 CTGTTGACGGGGCTGGTCTCCGG - Intronic
1170832187 20:19852066-19852088 CTGTGGTCGGGCTTGTGCTCTGG - Intergenic
1171016867 20:21549797-21549819 CTGTTGGCAGGTGTGTACCCAGG + Intergenic
1171382654 20:24745289-24745311 CTGCTGGAGGGCGTGTTCAGAGG - Intergenic
1175888440 20:62305207-62305229 CTGGTGGCGGGCCTGTGGTCAGG + Intronic
1176030280 20:63008285-63008307 CTCCTGGCGGGCGTGTGCTGGGG - Intergenic
1184007317 22:41719855-41719877 CTGGTTGAGGGCCTGTTCTCAGG + Intronic
954411409 3:50372831-50372853 GTGTTCTCCGGCGTGTTCTCAGG - Intronic
968046292 3:195625408-195625430 CTGCTGTCTGGCGTCTTCTCTGG + Intergenic
968308360 3:197664683-197664705 CTGCTGTCTGGCGTCTTCTCTGG - Intergenic
968609450 4:1550418-1550440 CAGGTGGCGAGCGTGTTCTCAGG + Intergenic
982159392 4:152552690-152552712 TTGTTGGCTGGTGGGTTCTCTGG + Intergenic
985412278 4:189697856-189697878 ATGTTGGCTGCTGTGTTCTCAGG + Intergenic
986787515 5:11127953-11127975 CTCTTGGAGGGGCTGTTCTCTGG - Intronic
989095525 5:37777887-37777909 CTGTTTGTTGGCGTGCTCTCGGG + Intergenic
992786751 5:80177353-80177375 CTGTTGGGGGCCATGTGCTCAGG - Exonic
1002552741 5:180008413-180008435 CTGTTGGGTGGCATGTTCTCTGG - Intronic
1005978856 6:30820612-30820634 CTGTTGGAGACCATGTTCTCTGG - Intergenic
1008189038 6:48431771-48431793 CTGGTGGAGGGCCTGTTCCCTGG - Intergenic
1014769431 6:125444649-125444671 CTGTTCACAGGCCTGTTCTCAGG - Intergenic
1023066391 7:36381706-36381728 CTGTTTGCTGGTGTATTCTCCGG - Intronic
1033820262 7:145126387-145126409 CTGTTAGAGGTTGTGTTCTCTGG + Intergenic
1042107158 8:65340377-65340399 CTGTTGCCTGGCATGGTCTCAGG + Intergenic
1062707210 9:137952355-137952377 CTGGTGCTGGGCGTGCTCTCGGG + Exonic
1203670315 Un_KI270755v1:5125-5147 ATGTTGGCTGCTGTGTTCTCAGG - Intergenic
1189714298 X:43849341-43849363 CTGCTGGCGTGCTTGTTATCTGG - Intronic