ID: 1097699482

View in Genome Browser
Species Human (GRCh38)
Location 12:62805424-62805446
Sequence CTAAGGTTGTTTCAGTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 766
Summary {0: 1, 1: 0, 2: 4, 3: 79, 4: 682}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097699482_1097699486 12 Left 1097699482 12:62805424-62805446 CCAAGACACTGAAACAACCTTAG 0: 1
1: 0
2: 4
3: 79
4: 682
Right 1097699486 12:62805459-62805481 GATGAATGGTAAAGAAAATGTGG 0: 6
1: 9
2: 60
3: 215
4: 931
1097699482_1097699484 -2 Left 1097699482 12:62805424-62805446 CCAAGACACTGAAACAACCTTAG 0: 1
1: 0
2: 4
3: 79
4: 682
Right 1097699484 12:62805445-62805467 AGCATCCATCAACAGATGAATGG 0: 27
1: 143
2: 1132
3: 2375
4: 4187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097699482 Original CRISPR CTAAGGTTGTTTCAGTGTCT TGG (reversed) Intronic
901189093 1:7394110-7394132 CTTAGGTTGATTCTATGTCTTGG + Intronic
901366689 1:8757826-8757848 CTTAGGTTGATTCTGTGTATTGG - Intronic
902564158 1:17299430-17299452 CTTAGGTTATTTCCATGTCTTGG - Intergenic
904228314 1:29043806-29043828 CGAAGGCTGTTGCAGAGTCTGGG + Intronic
904860076 1:33530673-33530695 CTTAGGTTGTTTCCGTATCTTGG - Intronic
905156589 1:35988689-35988711 CTTAGGTTGTTTCCATATCTTGG + Intronic
905330877 1:37195970-37195992 CTGTAGTTGTTTCTGTGTCTTGG - Intergenic
906817825 1:48897389-48897411 CTTAGGTTGATTCCGTATCTTGG + Intronic
907062333 1:51442488-51442510 CTAAACTTTTTTCAGTATCTGGG - Intronic
907083756 1:51649512-51649534 CTGATGTTGTTTCCTTGTCTTGG + Intronic
907642895 1:56209398-56209420 CTTAGGTTGTTTCCATATCTTGG - Intergenic
907660842 1:56391136-56391158 CTTAGGTTGTTTCCGTATCTTGG - Intergenic
907760984 1:57359668-57359690 CTTAGGTTGTCTCCGTATCTTGG - Intronic
907839891 1:58146850-58146872 CTTAGGTTGTTTCCATATCTTGG + Intronic
907935500 1:59038168-59038190 TTAAGGTTGTTTCCGTATCTTGG - Intergenic
908024389 1:59934932-59934954 CTTAGGTTGTTTCTATATCTTGG - Intergenic
908580229 1:65507599-65507621 CTTAGGTTGTTTCCATATCTTGG + Intronic
908877978 1:68699513-68699535 CCTAGGTTGTTTCAATGTCTTGG + Intergenic
909171833 1:72305460-72305482 CTAAGGTTGTTTCTATGTTTTGG + Intergenic
909385422 1:75049917-75049939 CTTAGGTTGATTCTGTATCTTGG - Intergenic
909845640 1:80390448-80390470 CTTAGGTTGATTCTGTCTCTTGG - Intergenic
911172945 1:94789410-94789432 CTTAGGTTGATTCCGTATCTCGG - Intergenic
911231005 1:95361739-95361761 ATTAGGTTGATTGAGTGTCTAGG + Intergenic
911843641 1:102719508-102719530 CTAAGGGTGATTCAATGTGTTGG + Intergenic
912047104 1:105472526-105472548 CTTAGGTTGTTTCTATTTCTTGG + Intergenic
912148781 1:106830321-106830343 CTTAGATTGTTTCAATATCTTGG - Intergenic
912268081 1:108179493-108179515 CTTAGGTTGATTCCGTATCTTGG - Intronic
912305882 1:108566609-108566631 CTTAGGTTGTTTCAATAACTTGG - Intronic
913119883 1:115730156-115730178 TTAGGGTTGTGGCAGTGTCTGGG - Intronic
913975900 1:143455008-143455030 CTTAGTTTGTTTCCATGTCTTGG - Intergenic
914070295 1:144280629-144280651 CTTAGTTTGTTTCCATGTCTTGG - Intergenic
914108860 1:144685725-144685747 CTTAGTTTGTTTCCATGTCTTGG + Intergenic
914418289 1:147504824-147504846 GGAAGGCTGTTTCAGTTTCTGGG + Intergenic
914778687 1:150763001-150763023 ATAAGGTTGATTCCGTATCTTGG - Intronic
916323152 1:163528325-163528347 CTAAGGTTGATCCCATGTCTTGG - Intergenic
916386349 1:164275557-164275579 CTGAGGTTGTTTCCATGTCTTGG - Intergenic
916625770 1:166553493-166553515 CTGAAGTTGCTTCAGTGTTTAGG - Intergenic
916820177 1:168390523-168390545 CTCAGGTTGTTTCCATATCTTGG - Intergenic
916821902 1:168407653-168407675 CTAAGGTCTTTACATTGTCTAGG + Intergenic
916877976 1:168990634-168990656 CTTAGGTTGTTTCCATGTCTTGG - Intergenic
917383634 1:174443131-174443153 CTTAGGTTGATTCCGTATCTTGG + Intronic
917402706 1:174668521-174668543 CTTAGGTTGATTCTGTATCTTGG + Intronic
917569876 1:176254033-176254055 CTTAGGTTGGTTCCATGTCTTGG + Intergenic
917670941 1:177272977-177272999 CTAAGGATGTCTCAGTGCCGAGG + Intronic
918256055 1:182748516-182748538 CTTAGGTTGATTCCATGTCTTGG + Intergenic
919394566 1:197028618-197028640 CTTAGGTTGTTTCTATATCTTGG + Intergenic
919525512 1:198644000-198644022 CTGAGGTTGATTCATTCTCTTGG + Intronic
919571143 1:199249504-199249526 CTTAGGTTGTTTCAATATCTTGG - Intergenic
920807074 1:209245048-209245070 ATTAGGTTATTCCAGTGTCTAGG - Intergenic
921197539 1:212773768-212773790 CTTAGGTTGATTCCGTATCTAGG - Intronic
921369745 1:214409477-214409499 CTTAGGTTGTTTCCATATCTTGG + Intronic
921741845 1:218694473-218694495 CTAAGGGTTTTTCAGCGTCATGG + Intergenic
921753997 1:218831621-218831643 CGTAGGTTGTTTCTGTATCTTGG - Intergenic
922131188 1:222780559-222780581 CTTAGGTTGTTTCCATATCTTGG + Intergenic
922379426 1:225007474-225007496 CTCAAGTTGTTTCAATGCCTGGG - Exonic
922549857 1:226486098-226486120 CTTAGGTTGATTCCGTGTCCTGG + Intergenic
922816897 1:228455739-228455761 TTAAGGTTTTTGCAGGGTCTGGG - Intergenic
923511080 1:234654250-234654272 CTTAGGTTGCTTCAATATCTTGG - Intergenic
924127955 1:240875443-240875465 CTTAGGTTGATTCTGTATCTTGG + Intronic
924617595 1:245626140-245626162 CTTAGGTTGATTCTGTATCTTGG + Intronic
1063057089 10:2517512-2517534 CTTAAGTTGTTTCCGTATCTTGG + Intergenic
1063926928 10:10988171-10988193 CTTAGGTTGGTTCCATGTCTTGG - Intergenic
1064798912 10:19046314-19046336 CTTAGGTTGTTTCCATATCTTGG - Intergenic
1065248204 10:23781017-23781039 CTTAGGTTGTTTCCATATCTTGG + Intronic
1065990532 10:31005203-31005225 CTTTGGTTGTTTCAATATCTTGG - Intronic
1066020979 10:31301537-31301559 CTCAGGTTGGTTCAATATCTTGG + Intergenic
1066154867 10:32664725-32664747 CTAAGTTTGATTCCGTATCTTGG + Intronic
1066333248 10:34448066-34448088 CTTAGGTTGTTTCCATATCTTGG - Intronic
1066678255 10:37911457-37911479 CTTAGGTTGTTTCTATATCTTGG + Intergenic
1068233878 10:54206861-54206883 CTAAGGATGTTTATGTGTGTGGG + Intronic
1069173168 10:65258131-65258153 CTTAGGTTGACTCTGTGTCTTGG - Intergenic
1069341226 10:67410780-67410802 CTTAGGTTGATTTTGTGTCTTGG - Intronic
1069350234 10:67517011-67517033 CTTAGGTTGTTTCAATATCTTGG + Intronic
1069849251 10:71394485-71394507 CTCAGGCTGCTGCAGTGTCTAGG - Intergenic
1069868215 10:71517292-71517314 GCAAGGTGCTTTCAGTGTCTGGG - Intronic
1070243991 10:74712597-74712619 CTTTGGTTGTTTCCATGTCTTGG + Intergenic
1070352621 10:75608047-75608069 CTTAGGTTGTTTCCCTCTCTTGG - Intronic
1070556939 10:77535621-77535643 CTCAGGTTGATTCCGTATCTTGG - Intronic
1071243054 10:83730332-83730354 CTTAGGTTGATTCCATGTCTTGG + Intergenic
1071333149 10:84581230-84581252 CTTAGGTTGATTCTGTATCTTGG - Intergenic
1071397086 10:85234916-85234938 ATCAGATTGTTTCATTGTCTTGG + Intergenic
1071708301 10:88023536-88023558 CTTAGGTTGTTTCCATATCTTGG - Intergenic
1071959375 10:90795068-90795090 TTTAGGTTGTTTCTATGTCTTGG + Intronic
1072363529 10:94684610-94684632 CTTAGGTTGTTTCCATATCTTGG + Intronic
1073702102 10:105938702-105938724 CTTAGGTTGATTCTGTATCTTGG - Intergenic
1073743153 10:106435045-106435067 CTAAGTTTTTTTCAGTTTGTTGG + Intergenic
1073781520 10:106843814-106843836 CTTAGGTTGTTTCCGTATCTTGG + Intronic
1075110825 10:119581730-119581752 TTAATGTCATTTCAGTGTCTTGG - Intronic
1075497670 10:122940130-122940152 TTTAGGTTGTTTCTGTATCTTGG - Intronic
1075531119 10:123230678-123230700 GTAATGATGTTTCAGGGTCTGGG - Intergenic
1076088593 10:127658662-127658684 GTAAAGCTGTTACAGTGTCTGGG - Intergenic
1076285594 10:129293032-129293054 TTTAGGTTGTTTCTGTATCTTGG - Intergenic
1076436486 10:130448459-130448481 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1077784807 11:5372180-5372202 CTTAGATTGTTTCCATGTCTTGG + Intronic
1077912566 11:6586328-6586350 CTTAGGTTGCTTCTGTATCTTGG - Intronic
1077925374 11:6677096-6677118 CTTAGATTGTTTCTGTATCTTGG - Intergenic
1078331840 11:10428874-10428896 CAAAGGATGTTGCAGTATCTTGG + Intronic
1078830972 11:14976230-14976252 CTTAGGCTGTTTCTGTATCTTGG - Intronic
1079434385 11:20432470-20432492 CTTAGGTTGATTCTGTATCTTGG + Intronic
1079866511 11:25742004-25742026 CTTAGGTTGTTTCCATATCTTGG - Intergenic
1079888938 11:26025823-26025845 CTTAGGTTGTTTCCATATCTTGG - Intergenic
1080594724 11:33761043-33761065 CTAAAGTTCTTTCATTGTCCAGG + Intronic
1080831528 11:35897588-35897610 CTAAGGTTCTTCCATTGTCCAGG + Intergenic
1081051910 11:38351707-38351729 CTTAAATTGTTTCTGTGTCTTGG + Intergenic
1085957429 11:81416600-81416622 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1086058200 11:82673170-82673192 GTAAAGTTGTTTTAGTCTCTGGG + Intergenic
1086242767 11:84715812-84715834 CTTAGGTTGTTTCCATATCTTGG + Intronic
1086461537 11:87010676-87010698 CTTAGGTTGTTTTAGTGTTGTGG - Intergenic
1087606058 11:100379633-100379655 CTTAGGTTGATTCAATTTCTTGG - Intergenic
1087867707 11:103252267-103252289 TTCAGGTTGTTTCCATGTCTTGG + Intronic
1088252806 11:107876190-107876212 CTAAGGTTCTTGCATTGTTTGGG - Intronic
1088297456 11:108316158-108316180 CTGAGGTTATTTCAGTATGTTGG + Intronic
1088681933 11:112251018-112251040 CTAGGTGTCTTTCAGTGTCTGGG + Intronic
1088946679 11:114520525-114520547 CTTATGTTGTTTCTCTGTCTTGG + Intergenic
1088961922 11:114676835-114676857 TTAACGTTGTTTCCATGTCTTGG - Intergenic
1088967683 11:114740357-114740379 CGTAGGTTGTTTCTGTATCTTGG + Intergenic
1089758071 11:120701532-120701554 CTTAGGTTGTTTCTATATCTTGG + Intronic
1090135772 11:124198256-124198278 CTTAGGTTGTTTCTGTATCTTGG + Intergenic
1090789980 11:130083739-130083761 TTTAGGTTGTTTCCATGTCTTGG + Intronic
1090899572 11:131016154-131016176 CTTAGGTTGATTCCATGTCTTGG + Intergenic
1090983412 11:131744658-131744680 CTAAAATTGTTTCAGAGTCCAGG - Intronic
1091314268 11:134600243-134600265 CTTAGGTTGTTTCCATATCTCGG - Intergenic
1091346943 11:134861298-134861320 TTTAGGTTGTTTTAATGTCTTGG - Intergenic
1091357926 11:134952252-134952274 CTTGGGTTGTTTCCCTGTCTTGG + Intergenic
1091650928 12:2309072-2309094 CTCAGGTTGTTTCAATATCTTGG - Intronic
1091686024 12:2563287-2563309 CTTAGGTTGATTCTGTATCTTGG + Intronic
1091855308 12:3734561-3734583 CTTAGGTTGTTTCCATGTCTTGG - Intronic
1092665039 12:10786903-10786925 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1093365880 12:18297936-18297958 CTTAGGTTGATTCCGTATCTTGG + Intronic
1093374330 12:18406290-18406312 CTAAGGTTGCTTCTATATCTTGG + Intronic
1093510927 12:19927438-19927460 TTTAGGTTGTTTCCATGTCTTGG + Intergenic
1093550642 12:20406144-20406166 CTTAGGTTGTTTCAATGTCTTGG + Intronic
1093670910 12:21874589-21874611 TTTGGGTTGTTTCAGTATCTTGG - Intronic
1093716389 12:22387597-22387619 CTTAGGCTGTTTCCATGTCTTGG - Intronic
1093820474 12:23611447-23611469 ATAAGGTTGATTCCATGTCTTGG + Intronic
1093984990 12:25520612-25520634 CTTAGGTTGTTTCCATATCTTGG + Intronic
1094355842 12:29576364-29576386 CTCAGGTTGTTTCCATATCTTGG - Intronic
1094633017 12:32196362-32196384 CTTAGGTTGTTTCCATATCTTGG - Intronic
1096173502 12:49493701-49493723 ATAAAGATGTTTCAGTGTATTGG - Intronic
1097481661 12:60133971-60133993 CTTAGGTTGTTTCCATATCTTGG - Intergenic
1097649491 12:62279389-62279411 TTAAGGTTGTTTCCGCATCTTGG + Intronic
1097699482 12:62805424-62805446 CTAAGGTTGTTTCAGTGTCTTGG - Intronic
1098139457 12:67436975-67436997 CTTAGGTTGATTCGGTATCTTGG + Intergenic
1098491570 12:71087044-71087066 CTTAGGTTGTTTCAAAATCTTGG + Intronic
1098596495 12:72278348-72278370 CTTAGGTTGGTTCTGTATCTCGG + Intronic
1098613425 12:72490550-72490572 CTTAGGCTGTTTCAATATCTTGG - Intronic
1098691528 12:73495341-73495363 CTTAGGTTGTTTCCCTATCTTGG - Intergenic
1098919242 12:76288097-76288119 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1099152536 12:79132828-79132850 CTTAGGTTGATTCAATATCTTGG - Intronic
1099230759 12:80021466-80021488 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1099416339 12:82391639-82391661 CTTAGGTTGTTTCCGTATTTTGG + Intronic
1099421234 12:82463494-82463516 CCAAGGTTGGTTCAATATCTTGG + Intronic
1099424236 12:82503102-82503124 CTTAGGTGGTTTCTGTATCTTGG + Intergenic
1099834648 12:87894249-87894271 CTTAGGTTGTTTCCATATCTTGG - Intergenic
1100342730 12:93696315-93696337 CTCAGGTTGATTCTGTATCTTGG - Intronic
1100873124 12:98933408-98933430 TTTAGGTTGTTTCTATGTCTTGG + Intronic
1100954927 12:99896508-99896530 CTTGGGTTGTTTCATTATCTTGG + Intronic
1101116261 12:101534424-101534446 CTTAGGTTGTTTTCATGTCTTGG - Intergenic
1101228578 12:102715168-102715190 CTTAGGTTGATTCTATGTCTTGG + Intergenic
1101417634 12:104522226-104522248 CTAAGGATGTTTGAATTTCTAGG - Intronic
1101668131 12:106839252-106839274 TTTAGGTTGTTTCAGTATCTTGG - Intronic
1102750876 12:115292870-115292892 CTTAGGTTGATTCCATGTCTTGG + Intergenic
1103017269 12:117505163-117505185 CTTAGGTTGGTTCCGTGTCTTGG + Intronic
1103423848 12:120813702-120813724 CTGAGATGGTTCCAGTGTCTTGG + Intronic
1104071705 12:125351503-125351525 CTTATGTTGTCTCAGTCTCTTGG - Intronic
1104225686 12:126830737-126830759 CTTAGGTTGTTTCTGCATCTTGG + Intergenic
1104468864 12:129012242-129012264 TTCAGGTTGTTTCTGTGTCTTGG + Intergenic
1105216296 13:18288285-18288307 CTGAGGTTGTCTTTGTGTCTTGG - Intergenic
1105565668 13:21545167-21545189 CTTAGGTTGATTCCATGTCTTGG - Intronic
1106754071 13:32803809-32803831 CTTAGGTTGTTTCCATATCTTGG - Intergenic
1108331475 13:49389298-49389320 CTTAGGTTGGTTCCATGTCTTGG - Intronic
1108506202 13:51114728-51114750 CTTTGGTTGTTTCCGTATCTTGG + Intergenic
1108703197 13:52961092-52961114 CTTACGTTGTTTCTGTATCTTGG + Intergenic
1108728775 13:53210123-53210145 CTTAGGTTGATTCTGTATCTTGG - Intergenic
1109000152 13:56790911-56790933 CTAAAGTTGTTTCAATGCTTTGG + Intergenic
1109076272 13:57840030-57840052 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1109433264 13:62264405-62264427 CTTAGGTTGTTTCCATCTCTCGG - Intergenic
1109672125 13:65622865-65622887 TTTAGGTTGTTTCTTTGTCTTGG + Intergenic
1109757453 13:66779313-66779335 CTTAGGTTGTTTCTATATCTTGG - Intronic
1109954864 13:69552425-69552447 ATTTGGTTGTTTCAGAGTCTGGG + Intergenic
1110243035 13:73289739-73289761 CTGCGGTTGCTTCAGTTTCTGGG - Intergenic
1110911897 13:80976143-80976165 CAGAGGTGGTTTCAGTGCCTTGG - Intergenic
1111400664 13:87730110-87730132 ATATGTTTGTTTCAGTGTATTGG - Intergenic
1111796092 13:92921924-92921946 CTTAGGTTGTTTCCATTTCTTGG + Intergenic
1112127506 13:96484758-96484780 CTTAGGTTGTTTCCATATCTTGG + Intronic
1112148674 13:96731502-96731524 CTTAGGTTGATTCTGTATCTTGG + Intronic
1112902744 13:104378651-104378673 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1113410767 13:110086927-110086949 CTTAGGTTGATTCTGTTTCTTGG - Intergenic
1113470631 13:110542728-110542750 CTTAGGTTGATTCTGTATCTTGG + Intronic
1114128893 14:19765520-19765542 CTTAAGTTGTTTCTGTATCTTGG + Intronic
1114154392 14:20084451-20084473 CTTAGGTTGTTTCCGTGTCTTGG - Intergenic
1114398023 14:22384289-22384311 CTAAGGATGTGACAGTGACTGGG + Intergenic
1114945973 14:27680596-27680618 TTAAGTGTGTTTCAGTTTCTAGG - Intergenic
1115346893 14:32352810-32352832 CTTAGGTTGATTCCGTATCTTGG + Intronic
1115460669 14:33656955-33656977 CTTAGGTTGATTCCGTATCTTGG - Intronic
1115674802 14:35660676-35660698 CTTAGGTTTTTTCCATGTCTTGG - Intronic
1115955719 14:38777096-38777118 CTGAGGTGGTTCCAGTGTCCTGG - Intergenic
1116222112 14:42100715-42100737 CTTAGGTTATTTCTGTGTCTTGG - Intergenic
1116753708 14:48919432-48919454 CTTAGGTTGGTTCCGTATCTTGG - Intergenic
1116972267 14:51078415-51078437 CTTAGGTTGTTTCCATATCTTGG - Intronic
1117232353 14:53733696-53733718 CTAAGGTTGATTCCATATCTTGG - Intergenic
1117293583 14:54357601-54357623 CTTAGGTTGATTCCGTATCTTGG + Intergenic
1117335827 14:54756494-54756516 CTAAGGTGCTTGCAGTTTCTGGG - Intronic
1117794864 14:59381968-59381990 CTTAGGTTGATTCCATGTCTTGG + Intergenic
1117865671 14:60146614-60146636 CTTAGGTTGTTTCCATATCTTGG - Exonic
1118044759 14:61955700-61955722 CTTAGGTTGATTCCGTATCTTGG + Intergenic
1118054763 14:62068126-62068148 CTTAGGTTGTTTCCTTATCTTGG - Intronic
1118886038 14:69866640-69866662 CCAGGGTTATTTCAGTGCCTTGG + Intronic
1119247071 14:73119558-73119580 TTAAGGTTGTTTTAGTGGCCGGG - Intronic
1119372307 14:74157370-74157392 CTTAGGTTGATTCTGTATCTTGG + Intronic
1119494308 14:75065377-75065399 CTAAGGTTGTATGATTCTCTAGG - Intronic
1119799684 14:77432500-77432522 CTTAGGTTGTTTCCATATCTTGG - Intronic
1120137998 14:80893055-80893077 CTTAGGTTGTTTCCATATCTTGG - Intronic
1120278267 14:82406395-82406417 CTGAGGTTGGTTAAGTGTCCTGG + Intergenic
1120321827 14:82972548-82972570 CTTAGGTTGTTTCCACGTCTTGG - Intergenic
1120579082 14:86224035-86224057 ATAAAATTGTTTCTGTGTCTAGG - Intergenic
1120931783 14:89856036-89856058 CTTAGGTTGTTTCTATATCTTGG + Intronic
1121161113 14:91741965-91741987 CTTAGGTTGTTTCCATATCTTGG - Intronic
1121232929 14:92371757-92371779 CTGAAGTGGTTTCATTGTCTGGG - Intronic
1121987551 14:98522587-98522609 CTTAGGTTGATTCTGTATCTTGG + Intergenic
1123106213 14:105842567-105842589 CTTAGGTTGGTTCTGTATCTTGG + Intergenic
1123453615 15:20393566-20393588 CTTAGGTTGTTTCTGTATCTTGG + Intergenic
1123508185 15:20967130-20967152 CCTAGGTTGCTTCCGTGTCTTGG + Intergenic
1123565405 15:21540877-21540899 CCTAGGTTGCTTCCGTGTCTTGG + Intergenic
1123601670 15:21978167-21978189 CCTAGGTTGCTTCCGTGTCTTGG + Intergenic
1123833643 15:24166711-24166733 GAAAGGTTGTTTTAGTCTCTCGG + Intergenic
1123869294 15:24554855-24554877 GAAAGGTTGTTTTAGTCTCTGGG + Intergenic
1123952504 15:25295188-25295210 CTTAGGTTGATTCCATGTCTTGG - Intergenic
1123954232 15:25317311-25317333 CTTAAATTGTTTCAATGTCTTGG + Intergenic
1124144126 15:27105855-27105877 CTTAGGTTGTTTCCATATCTTGG - Intronic
1124237201 15:28001186-28001208 CTTAGGTTGTTTCTGTATCTTGG - Intronic
1124252295 15:28114745-28114767 CTGAGGTGGCTTCATTGTCTCGG + Exonic
1124261389 15:28195126-28195148 CTAAGGTTTTTGCATTGTTTAGG + Intronic
1124709988 15:32000271-32000293 CTTAGGTTGATTCCATGTCTTGG - Intergenic
1124913918 15:33949942-33949964 CTTAGGTTGATTCTGTATCTTGG - Intronic
1125247501 15:37658216-37658238 CTGAGGTTGTTTCAATATTTTGG - Intergenic
1125387058 15:39149020-39149042 CTTAGGTTGTTTCCATATCTTGG - Intergenic
1126893387 15:53231473-53231495 CTTACGTTGTTTCGGTATCTTGG - Intergenic
1127024364 15:54786582-54786604 CTTAGGTTGTTTCCCTATCTTGG - Intergenic
1127101823 15:55573566-55573588 CTTATGTTGTTTCCATGTCTTGG - Intronic
1127256039 15:57294598-57294620 CTTAGGTTGATTCTGTATCTTGG - Intronic
1127316578 15:57800612-57800634 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1128414701 15:67434516-67434538 CTTAGGTTGTTTCCACGTCTTGG + Intronic
1128435803 15:67646601-67646623 CTAAGATTATTTCAGTGTTAGGG + Intronic
1128884390 15:71273122-71273144 CTTAGGTTGTTTCCATATCTTGG - Intronic
1129581401 15:76815340-76815362 TTAAGGTTGTTTCCATATCTTGG - Intronic
1130313833 15:82778267-82778289 TTGAGGTTGTTTCCATGTCTTGG - Intronic
1130440613 15:83949420-83949442 CTTAGGTTGTTTCCATATCTTGG + Intronic
1130718255 15:86358439-86358461 CTCAGGTTGTTTCAATATCTTGG + Intronic
1131321251 15:91393643-91393665 CTTAGATTGTTTCCATGTCTTGG + Intergenic
1131714058 15:95089390-95089412 CTTAGGTTGATTCCATGTCTTGG + Intergenic
1131844715 15:96477213-96477235 CTAAGGCTGTTTCCATATCTTGG + Intergenic
1132381924 15:101372063-101372085 CCAAGGCTGTTTCTGTGTCCAGG + Intronic
1202973777 15_KI270727v1_random:267967-267989 CCTAGGTTGCTTCCGTGTCTTGG + Intergenic
1134381316 16:13729315-13729337 TTTAGGTTGCTTCTGTGTCTTGG + Intergenic
1134420244 16:14080916-14080938 CTTAGGTTGCTTCTGTATCTTGG + Intronic
1134769267 16:16792197-16792219 CTTAGGTTGATTCTGTATCTTGG - Intergenic
1135090592 16:19511978-19512000 CTTAGGTTGATTCTGTATCTTGG + Intronic
1135159778 16:20083416-20083438 TTTAGGTTGTTTCTGGGTCTTGG - Intergenic
1135706060 16:24676041-24676063 TTGAGGTTATTTCAGTCTCTGGG - Intergenic
1137281659 16:46982045-46982067 CTTAGGTTGGTTCCATGTCTTGG + Intergenic
1137318660 16:47355121-47355143 CTCAGGTTGTTTCCTTATCTTGG - Intronic
1138992770 16:62411417-62411439 CTAAGGTTAATTCTGTATCTTGG + Intergenic
1140571282 16:76109071-76109093 CTTACATTGTTTCAATGTCTTGG - Intergenic
1140613302 16:76627587-76627609 CTTAGGTTGTTTCCATATCTTGG + Intronic
1140615232 16:76655135-76655157 CTTGGGTTGATTCCGTGTCTTGG + Intergenic
1140627062 16:76806544-76806566 TTTAGGTTGTTTCTGTGTCTTGG + Intergenic
1140716489 16:77730521-77730543 CTCAGGTTGATTCCATGTCTTGG + Intronic
1141071631 16:80961617-80961639 CTTAGGTTGTTTCTGTATCTTGG - Intergenic
1143394622 17:6582837-6582859 CTAAGGTTCTTGCATTGTATGGG - Intronic
1143935515 17:10480446-10480468 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1144063171 17:11601209-11601231 CTTAGGATGTTTCTGTCTCTTGG + Intronic
1144597086 17:16579258-16579280 CTAAGGTTGATTCCCTATCTTGG + Intergenic
1146470827 17:33123221-33123243 CTCTGGTTGTTTCAGAATCTTGG - Intronic
1146496199 17:33324671-33324693 CAAAGGTGGGTTCAGTGACTTGG - Intronic
1148769493 17:50058659-50058681 CTAAGGGTGGTTCTGTGTCTTGG + Intronic
1149279480 17:55086680-55086702 CTAAGGTTGATTCCATATCTTGG + Intronic
1149369975 17:55983903-55983925 CTTAGGTTGTTTCAATATCTTGG - Intergenic
1149730340 17:58939158-58939180 TTTAGTTTGTTTTAGTGTCTGGG - Intronic
1153117926 18:1683405-1683427 CTTAGGTTGCTTCCGTATCTTGG - Intergenic
1153137966 18:1939896-1939918 CTCAGGTTGTTTCCATATCTTGG + Intergenic
1153754813 18:8270585-8270607 TTTAGGTTGTTTCCATGTCTTGG - Intronic
1154325136 18:13384896-13384918 CTTAGGTTGCTTCCGTATCTTGG + Intronic
1155420183 18:25647501-25647523 CTTAGGGTGTTTCAGTGTTGAGG + Intergenic
1155430762 18:25754593-25754615 CTTAGGTTGATTCCATGTCTTGG - Intergenic
1155722520 18:29034602-29034624 CTCCTGTTGTTTCAGTGTATTGG + Intergenic
1156224775 18:35093495-35093517 CTAAGGTTGATTCCATTTCTTGG - Intronic
1157215314 18:45777958-45777980 CTAAGGTCCTTGCATTGTCTGGG - Intergenic
1157226605 18:45871509-45871531 CTTAGGTTGTTTCCATATCTTGG - Intronic
1157468485 18:47968980-47969002 CAAAGGTGGAATCAGTGTCTAGG - Intergenic
1157588787 18:48822571-48822593 TTTGGGTTGTTTCCGTGTCTTGG + Intronic
1157928857 18:51797116-51797138 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1157943943 18:51957971-51957993 GGAAGGTTGTTTCTGTCTCTGGG - Intergenic
1158732772 18:60043574-60043596 CTTAGGTTGTTTCTATATCTTGG - Intergenic
1158804620 18:60955298-60955320 CTTAGGTTGATTCCGTATCTTGG - Intergenic
1158819280 18:61140365-61140387 CTTAGGTTGTTTCTGTACCTTGG + Intergenic
1158854993 18:61534459-61534481 CTAAGGTTGTTTCTGTATCTTGG - Intronic
1158948494 18:62468923-62468945 CTTAGGTTGCTTCCATGTCTTGG + Intergenic
1159210444 18:65314475-65314497 CTTTGGTTGTTTCCGTATCTTGG - Intergenic
1159572356 18:70131424-70131446 CTAAGGTCCTTGCATTGTCTGGG + Intronic
1159763053 18:72452680-72452702 CTTAGGTTGTTTCCATATCTTGG - Intergenic
1164498840 19:28794295-28794317 GATAGGTTGTTTCTGTGTCTTGG + Intergenic
1164587157 19:29483275-29483297 GTCAGGGTGTTTCATTGTCTGGG + Intergenic
1165011948 19:32855029-32855051 CTTAGGTTGTGTCCATGTCTTGG - Intronic
1166009495 19:39931689-39931711 CTTAGGTTGATTCCGTATCTTGG - Intronic
1168009123 19:53515875-53515897 TTTAGGTTGTTTCCGTGTCTTGG - Intergenic
925373465 2:3364242-3364264 CTTAGGTTGATTCCATGTCTTGG - Intronic
925568389 2:5282145-5282167 CTTAGGTTGTTTCCATATCTTGG - Intergenic
925598843 2:5587632-5587654 CTGATGATGTTTCAGTGTCATGG - Intergenic
926481681 2:13405676-13405698 CTTAGGTTGTTTCTGTATCTTGG - Intergenic
926620800 2:15045623-15045645 CTTAGGTTGTTTCCATGCCTTGG + Intergenic
927299279 2:21492315-21492337 TTTAGGTTGTTTCCATGTCTTGG + Intergenic
928716658 2:34069114-34069136 CTCAGGTTGATTCTGTATCTTGG - Intergenic
929016251 2:37499200-37499222 CTAAGGTTGTCGTAGAGTCTTGG + Intergenic
929223844 2:39492419-39492441 CCAAGTTTGTTTCAGTCTGTGGG + Intergenic
929869066 2:45742868-45742890 CTTAGGTTGTTTCCATATCTTGG - Intronic
930287312 2:49446979-49447001 CTGAGGTTGATTCCGTATCTTGG - Intergenic
930487808 2:52030065-52030087 CTTAGGTTGTTTCCGTATCTTGG - Intergenic
930509805 2:52330066-52330088 CTAAGGTTGATTCCTTATCTTGG - Intergenic
930633373 2:53778797-53778819 CTTAGGTTGATTCCGTATCTTGG + Intronic
930854485 2:55998081-55998103 CTTAGTTTGTGTCTGTGTCTTGG - Intergenic
930878019 2:56241739-56241761 CTTAGGTTGTTTCAAAATCTTGG + Intronic
930889448 2:56366167-56366189 CTTAGGTTGTTTCCATATCTTGG + Intronic
930959370 2:57240631-57240653 CTTAGGTTGATTCTCTGTCTTGG - Intergenic
932140682 2:69274694-69274716 CTTAGGTTGATTCAGTATTTTGG - Intergenic
932263939 2:70350615-70350637 ATTAGGTTGTTTCCATGTCTTGG + Intergenic
932297146 2:70635364-70635386 CTTAGGTTGTTTCCATATCTTGG - Intronic
932361046 2:71106014-71106036 CTTAGGTTGATTCTGTGTCTTGG - Intergenic
933038354 2:77429430-77429452 CTTAGGTTGATTCTGTTTCTTGG - Intronic
933440639 2:82309220-82309242 CTCAGGTTGAGTCTGTGTCTTGG - Intergenic
933531877 2:83520973-83520995 CAAAAGTTGTTTCAGTCCCTTGG + Intergenic
933689330 2:85167479-85167501 CTCAGGTTGTTTCTGTAACTTGG - Intronic
934180598 2:89615990-89616012 CTTAGTTTGTTTCCATGTCTTGG - Intergenic
934290898 2:91690249-91690271 CTTAGTTTGTTTCCATGTCTTGG - Intergenic
934298030 2:91758439-91758461 CTGAGGTTGTCTTTGTGTCTTGG + Intergenic
934897470 2:98131360-98131382 CTTAGGTTGATTCCGTATCTTGG + Intronic
935029109 2:99305079-99305101 CTTAGGATGATTCTGTGTCTTGG - Intronic
935378723 2:102427163-102427185 CTAAGGTTGATTCCATATCTTGG + Intronic
936829181 2:116621041-116621063 CTTAGGTTGTTTGCGTATCTTGG - Intergenic
936870013 2:117125511-117125533 CTTAGGTTGTTTCTATATCTTGG + Intergenic
936901739 2:117488875-117488897 CTTAGGTTGTTTCCATATCTTGG - Intergenic
937085052 2:119166034-119166056 GTGAGCTTGTTGCAGTGTCTGGG + Intergenic
937135577 2:119549336-119549358 TTAAGGTTGCATCAATGTCTTGG + Intronic
937183172 2:120013597-120013619 CTGAGTTTGTGTCACTGTCTTGG + Intronic
937466092 2:122134288-122134310 CTTAGGTTGGTTCCATGTCTTGG + Intergenic
937878480 2:126846569-126846591 CTTAGGTTGGTTCGGTATCTTGG - Intergenic
938245486 2:129773909-129773931 CTTAGGTTGATTCTGTATCTTGG + Intergenic
938458955 2:131485326-131485348 CTAAACGTGTATCAGTGTCTGGG - Intronic
938963981 2:136370520-136370542 TTTAGATTGTTTCTGTGTCTTGG - Intergenic
940199684 2:151136857-151136879 CTTAGGTTGATTCTGTATCTTGG - Intergenic
940409068 2:153339033-153339055 CTTAGGTTGATTCCGTATCTTGG + Intergenic
940424491 2:153515003-153515025 CTAAGGGTTTTTAAGTGTTTTGG + Intergenic
940986712 2:160058411-160058433 CTAAGTCTGTGTCAGTGCCTGGG - Intronic
941056268 2:160792467-160792489 CTTAGGTTGATTCTGTATCTTGG - Intergenic
941680196 2:168389875-168389897 CTTAGGTTGTTTCCATATCTTGG - Intergenic
941705594 2:168655459-168655481 CTGAGGTTGTTTCCATATCTTGG - Intronic
942055275 2:172176560-172176582 CTAAGGTTGTTTCCATATTTTGG + Intergenic
942081723 2:172405952-172405974 CTTAGGTTGATTCCGTATCTTGG + Intergenic
942122274 2:172789873-172789895 TTTAGGTTGTTTCTGTATCTTGG + Intronic
942929924 2:181477923-181477945 CTAAGCTTGTTTCTGTAACTTGG - Intronic
943172238 2:184416502-184416524 CTAATTTTCTTTAAGTGTCTAGG + Intergenic
943460170 2:188163420-188163442 CTTAGGTTGTTTCCATATCTCGG - Intergenic
943476113 2:188357791-188357813 CTAAGGTTGATTCCATATCTCGG - Intronic
943866906 2:192937310-192937332 CTATGGATTTCTCAGTGTCTGGG + Intergenic
944261598 2:197683928-197683950 CTTAGGTTGCTTCCATGTCTTGG - Intergenic
944937554 2:204584999-204585021 CCAAGGTTGCTCCAGTCTCTGGG - Intronic
945181641 2:207097718-207097740 CTAAATTTGTTTCAGCATCTGGG - Intronic
945681582 2:212920389-212920411 CTTAGATTGTTTGAGTTTCTGGG - Intergenic
946591872 2:221258788-221258810 CTTAGGTTGTTTCCATGTCTTGG - Intergenic
947234756 2:227929082-227929104 CTTAGGTGGTTTCCATGTCTTGG + Intergenic
947476314 2:230450894-230450916 CTTAGGTTGTTTCTGTATCTTGG + Intronic
947997488 2:234540740-234540762 CTTAGGTTGATTCCGTGTCTTGG - Intergenic
1168896933 20:1330251-1330273 CTCAGGGTGTGTCAGTATCTGGG + Intronic
1169533746 20:6514010-6514032 CTTAGGTTGATTCCGTGTCTTGG - Intergenic
1170112410 20:12820055-12820077 CTTAGGTTGTTTCCATATCTTGG - Intergenic
1170200961 20:13743459-13743481 CTTAGGTTGTTTCCCTATCTTGG - Intronic
1170401945 20:15995921-15995943 CTTAGGTTGTTTCTGTGTCCTGG + Intronic
1170492673 20:16894645-16894667 TTTAGGTTGATTCAATGTCTTGG - Intergenic
1170619533 20:17983341-17983363 CTTAGGTTGTTTCCGCATCTTGG + Intronic
1170777054 20:19384591-19384613 CTTAGGTTGATTCAGAATCTTGG + Intronic
1171943946 20:31359018-31359040 CTGAGGTTGATTCTATGTCTTGG - Intergenic
1171944245 20:31362024-31362046 CTTAGGTTGATTCCATGTCTTGG - Intergenic
1172912826 20:38422687-38422709 CTTAGATTGTTTCCGTATCTTGG - Intergenic
1174873307 20:54203325-54203347 CTTAGGTTGTTTCTGAATCTTGG + Intergenic
1175255276 20:57641214-57641236 CCATGGTAGATTCAGTGTCTGGG - Intergenic
1176890222 21:14307519-14307541 CTTAGGTTGTTTCTATATCTTGG - Intergenic
1177246467 21:18531534-18531556 CTCAGGTTGATTCTGTATCTTGG - Intergenic
1177552354 21:22641313-22641335 CTTAGGTTGTTTCTATATCTTGG - Intergenic
1177750640 21:25279215-25279237 CTTAGGTTGTTTCCATGTCTTGG + Intergenic
1178222806 21:30679652-30679674 CTAAGGTTGTTTCCATATTTTGG - Intergenic
1178261698 21:31105967-31105989 CTAAGATTGTCTTAGTGTGTTGG + Intergenic
1178394683 21:32232055-32232077 CTTAGGTTGTTTCCATATCTTGG - Intergenic
1179158278 21:38870357-38870379 CTAAGGTTGATTCCGTATCTTGG + Intergenic
1179323779 21:40319498-40319520 CTTAAGTTGTTTCCATGTCTTGG + Intronic
1179953696 21:44726196-44726218 CTTAGGTTGATTCCGTATCTTGG - Intergenic
1180754831 22:18153975-18153997 CTTAGGTTGATTCCGTATCTCGG + Intronic
1181321866 22:22013673-22013695 CTTAGGTTGTTTCCGTTTCTTGG - Intergenic
1182140415 22:27951655-27951677 CTTAGGTTGATTCCGTATCTTGG + Intergenic
1182163610 22:28149335-28149357 CTTAGGTTGATTCTGTATCTTGG - Intronic
1182175678 22:28285069-28285091 CTTAGGTTGTTTCCATATCTTGG - Intronic
1182176309 22:28293185-28293207 CTTAGGTTGTTTCCATATCTTGG - Intronic
1182206847 22:28636483-28636505 CTTAGGTTGTTTCTATATCTTGG + Intronic
1182214128 22:28701724-28701746 CTGAGTATCTTTCAGTGTCTTGG - Intronic
1182957523 22:34441148-34441170 GTTAGGTTGGTTCAGTATCTTGG - Intergenic
1184811868 22:46840991-46841013 CTTGGGTTGTTTCCATGTCTTGG - Intronic
1184917063 22:47576881-47576903 CTGGGGTTGTTTCCGTATCTTGG + Intergenic
949397703 3:3632760-3632782 TTTAGGTTGTTTCTGTATCTTGG - Intergenic
949429117 3:3953869-3953891 CTTAGGTTGTTTCTGTATCTTGG + Intronic
949863236 3:8525477-8525499 CTTAGGTTGTTTCCATATCTTGG + Intronic
950243859 3:11396856-11396878 CTAAGGTTCTTGCATTGTCTTGG + Intronic
950289969 3:11775687-11775709 CTTAGGTTGTTTCCATATCTTGG - Intergenic
950694323 3:14686247-14686269 TTTAGGTTGTTTCCATGTCTTGG + Intronic
951406179 3:22301016-22301038 CCTAGGTTGTTTCTGTATCTTGG - Intronic
951418924 3:22460714-22460736 CTTAGGTTGTTTCCATATCTTGG - Intergenic
952584410 3:34873497-34873519 CCAAGGTTGGTTCAGTGCCCTGG + Intergenic
953199210 3:40763112-40763134 CTTAGGTTGTTTCAAAATCTTGG - Intergenic
953643040 3:44727567-44727589 CTAAGGTTATTTTAGTGTTTTGG + Intergenic
953817565 3:46172706-46172728 ATTAGTTTGTTTCTGTGTCTTGG + Intronic
953999604 3:47545386-47545408 CTAAGGTTCTTTAATTGCCTGGG + Intergenic
954471550 3:50700691-50700713 CTTAGGTTGATTCCGTATCTTGG + Intronic
954881626 3:53839791-53839813 CTTAGGTTGATTCCATGTCTTGG - Intronic
955073566 3:55592040-55592062 CTGGGGCTGTTTCAGTGTGTAGG + Intronic
955185764 3:56713433-56713455 CTAGGGTTGCTTCCATGTCTTGG + Intergenic
955469034 3:59266964-59266986 TTTAGGTTGTTTATGTGTCTTGG + Intergenic
955486716 3:59441690-59441712 CTTAGGTTGTTTCCATATCTTGG + Intergenic
955760874 3:62280788-62280810 CTTAGGTTGTTTCCGTATCTTGG - Intronic
956385578 3:68714925-68714947 GTATGTTTCTTTCAGTGTCTTGG + Intergenic
956472894 3:69587238-69587260 CTTAGGTTGATTCTATGTCTTGG - Intergenic
957067920 3:75541017-75541039 CTTAGGTTGATTCTGTATCTTGG - Intergenic
957278905 3:78124969-78124991 CTAAGGAGGTTTCAGTAACTGGG - Intergenic
958090216 3:88867909-88867931 CTTAGGTTGTTTCCATATCTTGG + Intergenic
958497780 3:94866285-94866307 CTTAGGTTGATTCCATGTCTTGG + Intergenic
958529408 3:95307513-95307535 CTTAGGTTGTTTCCATATCTTGG + Intergenic
958671858 3:97216270-97216292 ATAAGGTTGTTTAAAAGTCTAGG - Intronic
958685918 3:97393982-97394004 GTCAGGTTGATTCAGTCTCTTGG + Intronic
958694790 3:97513399-97513421 CTTAGGTTGATTCAATATCTTGG - Intronic
959174789 3:102893469-102893491 CTTAGGTTGATTCTGTATCTTGG - Intergenic
959716107 3:109434349-109434371 CTTAGGTTGTTTCCATATCTAGG - Intergenic
959829018 3:110837765-110837787 CTTAGGTTGTTTCCATATCTTGG + Intergenic
960059173 3:113302183-113302205 CTTAGGTTGATTCCGTGTCTTGG + Intronic
960243056 3:115368039-115368061 CTTTGGTTGTTTCCATGTCTTGG - Intergenic
960273074 3:115695746-115695768 CTAAAGTTGTTTCACTGGATGGG - Intronic
960460309 3:117926067-117926089 CTTAGGTTGATTCTGTGTCTTGG - Intergenic
961068331 3:123895998-123896020 CTTAGGTTGATTCTGTATCTTGG - Intergenic
961106338 3:124245398-124245420 GTAAGGTTGATTCCATGTCTTGG + Intronic
961191304 3:124964360-124964382 CTTAGGTTGTTTCTATGTTTTGG - Intergenic
962018779 3:131474129-131474151 CTTAGGTTGATTCTGTATCTTGG - Intronic
963417265 3:145013626-145013648 TTAAGGTTATCTCAGTTTCTTGG - Intergenic
963820358 3:149885139-149885161 CTTAGGTTGTTTCCAAGTCTTGG + Intronic
963827938 3:149974939-149974961 CTAAGGTTTTTGGATTGTCTAGG - Intronic
965042622 3:163530266-163530288 CTAAGATTGATTCAATTTCTTGG - Intergenic
965781138 3:172287303-172287325 CTGAGTTTGTTTCACTGTCAGGG + Intronic
966337987 3:178892222-178892244 CTAAGGTTGTTTCCAAATCTTGG - Intergenic
966420583 3:179730822-179730844 GTAATGTCATTTCAGTGTCTAGG + Intronic
966663091 3:182436980-182437002 CTAAGGTTGTTTAAATGTTTAGG + Intergenic
967710540 3:192702275-192702297 CTTAGGTTGTTTCCATATCTTGG + Intronic
967762940 3:193245449-193245471 CTTAGGTTGCTTCTGTATCTTGG + Intronic
970332475 4:15001725-15001747 CTAAGCTTGTTTCTGTTTTTAGG - Intergenic
970683549 4:18538686-18538708 CTTAGCTTGTTTCCATGTCTTGG + Intergenic
970946664 4:21700983-21701005 CTTAGGTTGCTTCTGTATCTTGG - Intronic
971211132 4:24617633-24617655 CTTAGGTTGATTCTGTGTCTTGG + Intergenic
971402858 4:26292874-26292896 CTTAGGTTGTTTCCATGTCTTGG + Intronic
971458632 4:26869885-26869907 TTAAGGTTGTTTCCATATCTTGG - Intronic
971511727 4:27434734-27434756 TTTAGGTTGATTCAATGTCTTGG - Intergenic
971663527 4:29452019-29452041 CTTAAGTTCTTTCTGTGTCTTGG - Intergenic
972141848 4:35970099-35970121 CTAAAGCTGTTGCAGTGCCTTGG + Intronic
972668607 4:41192369-41192391 CTTAGGTTGTTTCCGTATCTTGG - Intronic
972722428 4:41713613-41713635 ATCTGGTTGTTTAAGTGTCTGGG - Intergenic
972764363 4:42138164-42138186 ACAAGGTTGTTTCCATGTCTTGG - Intronic
972950981 4:44322011-44322033 CTTAGGTTGATTCTGTATCTTGG + Intronic
973813510 4:54596516-54596538 CTTAGGTTGTTTCCATATCTTGG - Intergenic
974481366 4:62448028-62448050 CTCAGGTTGTTTCCATATCTTGG - Intergenic
974579835 4:63782032-63782054 CTTAGGTTGTTTCCATATCTTGG + Intergenic
975101325 4:70516602-70516624 CCAACATTGTGTCAGTGTCTGGG - Intergenic
975217764 4:71776232-71776254 CTTAGGTTGTTTCAGCATCTCGG - Intronic
975388379 4:73786034-73786056 CTAAGGTTGATTCCATATCTTGG - Intergenic
975707390 4:77124617-77124639 CTTAGGTTGACTCTGTGTCTTGG + Intergenic
976533241 4:86180577-86180599 CTAAGGTTGATTCCATGTCTTGG - Intronic
977763495 4:100770274-100770296 CTTAGGTTGATTCCATGTCTTGG + Intronic
978081613 4:104599949-104599971 CTTAGGTTGTTTCTATATCTTGG + Intergenic
978292797 4:107165341-107165363 CTTAGGTTAATTCTGTGTCTTGG - Intronic
979075960 4:116270882-116270904 CTTAGGTTGATTCCGTATCTTGG + Intergenic
979471255 4:121099961-121099983 CTTAGGTTGATTCCATGTCTTGG + Intergenic
980095464 4:128485568-128485590 CTAAAGTTGTTTATATGTCTAGG - Intergenic
980146665 4:128994425-128994447 CTAAGGTTGTTTTCGTATCTTGG + Intronic
980391249 4:132150633-132150655 CTTAAGTTGATTCCGTGTCTTGG + Intergenic
981450594 4:144892947-144892969 CTTAGGTTGTTTCCATATCTTGG + Intergenic
981772359 4:148324438-148324460 CTTAGGTTGTTTCCATATCTTGG + Intronic
981860763 4:149353514-149353536 TTAAGGTTGTTTCCATATCTTGG - Intergenic
982032094 4:151310937-151310959 CTTAGGTTGTTTATGTATCTTGG - Intronic
982397855 4:154931619-154931641 CTTAGGTTGATTCAATATCTTGG + Intergenic
982613378 4:157607046-157607068 CTTAGGTTGATTCTGTATCTTGG - Intergenic
982710277 4:158751208-158751230 CTTAGGTTGATTCCATGTCTTGG - Intergenic
983030459 4:162795139-162795161 CTTAGGTTGTTTCTATGTCTTGG - Intergenic
983145614 4:164210779-164210801 CTTAGGTTGCTTCCTTGTCTTGG - Intronic
983910459 4:173233147-173233169 CTTAGGTTGATTCTGTATCTTGG + Intronic
984075449 4:175172416-175172438 CTTAGTTTGTTTCCGTATCTTGG + Intergenic
984176221 4:176420704-176420726 CTAAGGTTGTTTCTATGTCTTGG - Intergenic
984443923 4:179809310-179809332 CTTAGGTTGTTACCGTATCTTGG - Intergenic
984634421 4:182095256-182095278 CTTAGGTTGATTCTGTATCTTGG - Intergenic
985188219 4:187341624-187341646 CTTAGGTTGGTTCTGTGACTTGG - Intergenic
985853659 5:2408162-2408184 CTTAGGTAGTTTCCATGTCTCGG - Intergenic
986131239 5:4933538-4933560 CTTAGGTTGTTTCTATGTCTTGG - Intergenic
986394040 5:7310816-7310838 CTTAGGTTGTTTCCATATCTTGG + Intergenic
986475342 5:8124741-8124763 CTAAGGTTGTTTCCAAATCTTGG - Intergenic
987233747 5:15922058-15922080 CCTAGGTTGTTTCAGTATCTCGG - Intronic
987380961 5:17285662-17285684 CTTAGGTTGATTCCGTATCTTGG - Intergenic
987532377 5:19138840-19138862 CTAAGCTAGTTTCAGTCTATAGG - Intergenic
987859927 5:23471678-23471700 CTTAGGTTGATTCTGTATCTTGG + Intergenic
987888239 5:23839381-23839403 CTAAGATAGTTTACGTGTCTAGG + Intergenic
987903228 5:24040781-24040803 TTTAGGTTGTTTCAATATCTTGG + Intronic
988329439 5:29815858-29815880 TTTAGGTTGTTTCCATGTCTTGG - Intergenic
988394894 5:30684253-30684275 CTTAGGTTGTTTCCATATCTTGG - Intergenic
988881705 5:35510503-35510525 CTCAGGTTGTTTCCATATCTTGG - Intergenic
989181715 5:38584424-38584446 CTTAGGTTGTTTCCATGTCTTGG - Intronic
989392623 5:40917537-40917559 CTTAGGTTGGTTCTGTATCTTGG + Intronic
990880757 5:60535102-60535124 CAAAGGTTGTTTCCATATCTTGG + Intergenic
991350023 5:65711541-65711563 CTGTGGTTCTTTCATTGTCTGGG - Intronic
991567273 5:68018472-68018494 CTTAGGTTGGTTCCGTATCTTGG - Intergenic
992167030 5:74063629-74063651 CTTGGGTTGTTTCTGTATCTTGG - Intergenic
992800349 5:80289979-80290001 CTTAGGTTGTTTCCATATCTTGG - Intergenic
993029017 5:82682075-82682097 CTTGGGTTGTTTCCGTATCTTGG + Intergenic
993236845 5:85321809-85321831 CTTACGTTGTTTCAATATCTTGG - Intergenic
994566514 5:101453364-101453386 CTTAGGTTGTTTCCATATCTTGG - Intergenic
994612471 5:102061131-102061153 CTTAGGTTGTTTCCATATCTTGG + Intergenic
994947873 5:106419350-106419372 CCAATGTTGTTTTAGTGACTGGG + Intergenic
995810295 5:116099359-116099381 CTTAGGTTGTTTCCTTATCTTGG + Intronic
995903150 5:117093462-117093484 GAATGGTGGTTTCAGTGTCTGGG - Intergenic
995975541 5:118031646-118031668 CTTAGGTTGATTCCATGTCTTGG - Intergenic
996244484 5:121244315-121244337 TTAAGGTTGTTTCCATATCTTGG - Intergenic
996438634 5:123463764-123463786 CTTAGGTTGTTTCCATCTCTTGG + Intergenic
996452236 5:123638427-123638449 CTTAGGTTGATTCCATGTCTTGG - Intergenic
997059560 5:130485106-130485128 CTTAGGTTGTTTCCATATCTTGG + Intergenic
997096378 5:130917961-130917983 CTTAGATTGATTCCGTGTCTTGG - Intergenic
997122697 5:131191973-131191995 CTTAGGTTGATTCCGTATCTTGG - Intronic
998571309 5:143260787-143260809 CTTAGATTGTTTCCCTGTCTTGG + Intergenic
998597555 5:143549091-143549113 CTTAGGTTGTTTCTATATCTTGG + Intergenic
998723599 5:144983038-144983060 TTTAGGTTGTTTCCATGTCTTGG - Intergenic
998734382 5:145118969-145118991 CTAGGGTTGTTTCCATATCTTGG + Intergenic
998928252 5:147151804-147151826 CTTAGGTTGTTTCCGTATCTTGG - Intergenic
999192832 5:149761555-149761577 CTTAGGTTGTTTCCATATCTTGG - Intronic
999714223 5:154346212-154346234 CTTAGGTTGTTTCCATATCTTGG + Intronic
999840572 5:155421431-155421453 CTTAGGTTGTTTCCATATCTGGG + Intergenic
1000610954 5:163373701-163373723 CTTAGGTTGATTCCCTGTCTTGG - Intergenic
1000695659 5:164378581-164378603 CTTAGGTTGATTCTGTGTCTTGG + Intergenic
1000777198 5:165434645-165434667 CTTAGATTGTTTCCATGTCTTGG + Intergenic
1001018728 5:168164781-168164803 CAGAGGTTGTTTCAGAGTGTAGG + Intronic
1001194692 5:169661873-169661895 CTTGGGTTGTTTCCGTATCTTGG + Intronic
1001666832 5:173440214-173440236 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1001678832 5:173541076-173541098 CTTAGGTCGTTTCTGTATCTTGG - Intergenic
1001696817 5:173676320-173676342 CTAAGCCTGTTTCAGTCTCTAGG + Intergenic
1002609590 5:180406778-180406800 CTTAGATTGTTTCTGTATCTCGG - Intergenic
1003054814 6:2808555-2808577 CTTAGATTGTTTCATTATCTTGG - Intergenic
1003056930 6:2829918-2829940 CTAAGGTCCTTGCATTGTCTGGG - Intergenic
1003411551 6:5867766-5867788 CTTAGGTTGTTTCCATGTCTTGG - Intergenic
1004026721 6:11826647-11826669 CTTAGGTTGATTCTGTATCTTGG + Intergenic
1004391910 6:15217078-15217100 CAAAGGTTGTATGAGTGTCCAGG - Intergenic
1004882139 6:20019848-20019870 CTTAGGTTGTTTCCATATCTTGG - Intergenic
1005026168 6:21465059-21465081 CCAAGAATGTTTCTGTGTCTCGG + Intergenic
1005184722 6:23152633-23152655 CTTTGGTTGTTTCCGTATCTTGG + Intergenic
1005267457 6:24126786-24126808 CTGAAGATGTTTCAGTGTTTTGG + Intronic
1005720234 6:28594312-28594334 CTTAGGTTGATTCCATGTCTTGG - Intronic
1005794631 6:29346699-29346721 CTTAGGTTGATTCCATGTCTTGG - Intergenic
1006306641 6:33225209-33225231 CTTAGGTTGTTTCCATGTCTTGG - Intergenic
1007953122 6:45890640-45890662 CTTAGGTTGTTTCCATATCTTGG - Intergenic
1008181326 6:48333449-48333471 CTGAGGTTGCTTCCATGTCTTGG + Intergenic
1008193491 6:48489127-48489149 CTTAGGTTGTTTCCATATCTTGG - Intergenic
1008658190 6:53637727-53637749 CTTAGGTTGATTCCATGTCTAGG + Intergenic
1008864863 6:56197933-56197955 CTTAGGTTGTTTCCATATCTCGG - Intronic
1008967981 6:57334321-57334343 CTTAGGTTGATTCCGTATCTTGG + Intronic
1009687447 6:66981539-66981561 CTTAGATTGTTTCCGTATCTTGG + Intergenic
1010888448 6:81273119-81273141 CTTAGGTTGTTTCCATATCTTGG - Intergenic
1011372924 6:86658660-86658682 CTTAGGTTGTTTCCGTATCTTGG - Intergenic
1011796936 6:90966248-90966270 TTAAGTCTGTTTCAGTGTATTGG + Intergenic
1011834164 6:91409386-91409408 TTTAGGTTGTTTCCATGTCTTGG + Intergenic
1012162341 6:95901584-95901606 CTTAGGTTGACTCTGTGTCTTGG + Intergenic
1012295697 6:97519859-97519881 CTAAGTTTGATTCTGTATCTTGG - Intergenic
1012646725 6:101693459-101693481 CTTAGGTTTGTTCATTGTCTGGG + Intronic
1012772900 6:103462551-103462573 ATAGGTTAGTTTCAGTGTCTTGG + Intergenic
1013563122 6:111326689-111326711 CTTAGGTTGTTTCCATATCTTGG - Intronic
1013922641 6:115426837-115426859 CTTAAGTTGTTTCCATGTCTTGG - Intergenic
1014120130 6:117715341-117715363 CTTAGGTTGATTCCATGTCTTGG + Intergenic
1014478608 6:121906760-121906782 CTTAGGTTGATTCTATGTCTTGG + Intergenic
1015695307 6:135973385-135973407 CTTAGGTTGTTTCCATATCTTGG + Intronic
1015961865 6:138658600-138658622 CAAAGGTTGTTTCCATATCTTGG + Intronic
1016110684 6:140219457-140219479 CTAAGTTAGATTCAGGGTCTGGG + Intergenic
1016405232 6:143723037-143723059 CTTAGGTTGATTCTATGTCTTGG + Intronic
1016950504 6:149574919-149574941 CTAAGGTTCTTGCATTGTTTGGG - Intronic
1016955178 6:149619895-149619917 CTTAGGTTGATTCCATGTCTTGG - Intronic
1016983136 6:149871452-149871474 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1017199959 6:151742168-151742190 CTTAGGTTGTTTCCATATCTTGG + Intronic
1018059009 6:160075602-160075624 CTAAGGTTGGTTCTATTTCTAGG - Intronic
1018377340 6:163225790-163225812 CTTAGGTTGATTCCATGTCTTGG - Intronic
1019054286 6:169211828-169211850 CTTAGGTTGATTCGATGTCTTGG - Intergenic
1019812851 7:3177190-3177212 GGAAGGTTGTATCAGTTTCTGGG - Intergenic
1021001606 7:15338592-15338614 TTAAAGTTGTTTCAGTTTTTAGG - Intronic
1021217515 7:17935100-17935122 CTTAGGTTGATTCTTTGTCTTGG - Intronic
1021326415 7:19274589-19274611 CTTGGGTTGCTTCTGTGTCTTGG + Intergenic
1021545498 7:21808794-21808816 CTTAGGTTGATTCCGTGTCTTGG + Intronic
1022050906 7:26670442-26670464 CTGAGGTAGTTTCATTTTCTAGG - Intronic
1022788861 7:33666415-33666437 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1022918451 7:34985887-34985909 TTAGGGTTGCTTCCGTGTCTTGG - Intronic
1023590473 7:41776114-41776136 CTTAGGTTGTTTCTATATCTTGG + Intergenic
1023729923 7:43181255-43181277 CTTAGGTTGTTTCCATGGCTTGG + Intronic
1024161072 7:46676925-46676947 CTTAGATTGTTTCCGTATCTTGG - Intronic
1024357724 7:48432550-48432572 CTTAGGTTGATTCCATGTCTTGG - Intronic
1024371600 7:48590398-48590420 CTTAGGTTGTTTCTATATCTTGG + Intronic
1025974498 7:66359114-66359136 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974536 7:66359300-66359322 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974548 7:66359360-66359382 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974561 7:66359423-66359445 CTAAGGTTCTTCAAGTGTCCAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026066394 7:67077156-67077178 CTTAGGTTGGTTCTGTATCTTGG + Intronic
1026097610 7:67358950-67358972 CAAAGGTGGTTTCAGTTGCTGGG + Intergenic
1026531566 7:71203058-71203080 CTTAGGTTGATTCTGTGTCTTGG + Intronic
1026710531 7:72735183-72735205 CTTAGGTTGGTTCTGTATCTTGG - Intronic
1027429991 7:78101940-78101962 CTTAGGTTGTTTTCGTATCTTGG - Intronic
1027822752 7:83068854-83068876 CTTTGGTTGTTTCCATGTCTTGG - Intronic
1028397016 7:90381043-90381065 CTGAGGTTGATTCCATGTCTCGG + Intronic
1028521487 7:91736056-91736078 CTTAGGTTGTTTCAAAATCTTGG + Intronic
1029362508 7:100097757-100097779 TTAAGGTTGTTTTATTTTCTGGG + Intronic
1030062062 7:105630161-105630183 CTTAGGTTGTTTCCATATCTTGG + Intronic
1030250315 7:107436187-107436209 TTTAAGTTGCTTCAGTGTCTTGG - Intronic
1030388352 7:108893587-108893609 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1030393832 7:108960953-108960975 CTAAGTTTGATTCTGTATCTTGG + Intergenic
1030547485 7:110915169-110915191 CTTAAGTTGTTTCAGTACCTTGG - Intronic
1030790795 7:113725689-113725711 CTAAGGTGGTTTCCATATCTTGG - Intergenic
1031188754 7:118518971-118518993 CTTAGGTTGTTTCCATGTTTTGG - Intergenic
1031835694 7:126679484-126679506 ATAAAGTTGTTTCACTCTCTAGG - Intronic
1031876668 7:127149642-127149664 CTTAGGTTGTTTCCCTGTCTTGG - Intronic
1032330264 7:130972508-130972530 TTTAGGTTGTTTCCGTATCTTGG + Intergenic
1033083759 7:138322938-138322960 CTTAGGTTGTTTCCATTTCTTGG - Intergenic
1033183207 7:139201074-139201096 CTTAGGTTGTTTCCATGTCTTGG + Intergenic
1033562900 7:142549999-142550021 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1033647133 7:143314220-143314242 CTTAGGTTGTTTCCATTTCTAGG + Intergenic
1033800858 7:144900247-144900269 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1033886145 7:145948624-145948646 CTTAGGTTGATTCTGTATCTTGG - Intergenic
1034285982 7:149883241-149883263 CTAGGGTTGGTCCAGTCTCTTGG + Intergenic
1034750622 7:153565491-153565513 CTTAGGTTGATTCCATGTCTTGG - Intergenic
1036026185 8:4911704-4911726 CTAGAGTTGATTCAGTTTCTGGG - Intronic
1036481415 8:9142919-9142941 CTTAGGTTGATTCCGTATCTTGG + Intronic
1036670461 8:10781913-10781935 CTTAGGATGTTTCCATGTCTTGG - Intronic
1036836904 8:12079010-12079032 CTTAGGTTTTTTCAATATCTTGG - Intergenic
1036858696 8:12325256-12325278 CTTAGGTTTTTTCAATATCTTGG - Intergenic
1037400186 8:18487888-18487910 TTGAGGTTGTTTCTATGTCTTGG - Intergenic
1037854641 8:22362295-22362317 CTCAGGTTGTTTCCATATCTTGG - Intergenic
1038599803 8:28928589-28928611 CTTAGGTTGTTTCCATATCTTGG - Intronic
1038654836 8:29440040-29440062 CTAAGGTCATTGCATTGTCTGGG + Intergenic
1039359953 8:36865435-36865457 CTTAGGTTGTTTCTGTATCTTGG - Intronic
1040640480 8:49328672-49328694 CTTAGGTTGTTTCTATATCTTGG + Intergenic
1041331048 8:56725510-56725532 CTTAGGTTGTTTCCATATCTTGG - Intergenic
1042017341 8:64328754-64328776 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1042491814 8:69407957-69407979 CTTAGGTTGATTCTGTATCTTGG - Intergenic
1042848814 8:73194814-73194836 TTTAGGTTGTTTCCGTATCTTGG + Intergenic
1043292907 8:78626154-78626176 CTTAGGTTGATTCTGTATCTTGG + Intergenic
1044033754 8:87271836-87271858 CTTAGGTTGCTTCTGTATCTGGG - Intronic
1044498070 8:92914940-92914962 CTTAGGTTGTTTCCATATCTTGG - Intronic
1044991014 8:97795892-97795914 CTAAGGTCCTTGCATTGTCTAGG - Intronic
1045812187 8:106234827-106234849 GTAAGGTTGTTTCTATATCTTGG - Intergenic
1045931370 8:107630721-107630743 CAAAGGTTGTTTCAATGTCATGG - Intergenic
1046276954 8:111974131-111974153 CTTAGGTTGATTCCATGTCTTGG - Intergenic
1046426985 8:114066827-114066849 CTTAGGTTTTTTCAGCATCTTGG - Intergenic
1046521611 8:115332909-115332931 CTTAGGTTGTTTCCCTATCTTGG - Intergenic
1046672418 8:117070956-117070978 CTTAGGTTGTTTTCATGTCTTGG + Intronic
1047550292 8:125864370-125864392 CCAAGGTTGTTTCCATATCTTGG + Intergenic
1047935608 8:129775144-129775166 CTTAGGTTGTTTTGGTGTCTTGG - Intronic
1047981646 8:130189565-130189587 CTTAGGTTGATTCCGTATCTTGG + Intronic
1048492272 8:134904937-134904959 CTTAGGTTGATTCTATGTCTTGG - Intergenic
1048814125 8:138315551-138315573 CTTATGTTGTTTCTGTATCTGGG - Intronic
1049066020 8:140314852-140314874 CTTAGGTTGATTCCGTATCTTGG + Intronic
1049114692 8:140675988-140676010 CTTAGGTTGATTCTGTATCTTGG - Intronic
1049925332 9:401706-401728 CAAAGATTGTTTCTGTGTATTGG - Intronic
1050438453 9:5634145-5634167 CTTAGGTTGTTTCTGTATCTTGG + Intronic
1050886156 9:10768925-10768947 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1050956700 9:11670550-11670572 CTTAGGTTGACTCAGTATCTTGG + Intergenic
1051110838 9:13633744-13633766 CTTAGGTTGGTTCCGTATCTTGG - Intergenic
1051227645 9:14918733-14918755 CTTAGGTTGTTTCCGTATGTTGG - Intergenic
1051319525 9:15886695-15886717 CTTAGGTTGTTTCTATATCTTGG - Intronic
1051920983 9:22264268-22264290 CTTAAGTTGATTCCGTGTCTTGG + Intergenic
1051983621 9:23055647-23055669 CTCAGGTTGTTTCTATATCTTGG - Intergenic
1051983697 9:23056922-23056944 CTTAGGTTGTTTCTATATCTTGG + Intergenic
1052010433 9:23401410-23401432 CTTAGGTTGTTTCCATATCTTGG - Intergenic
1052077894 9:24166719-24166741 TTTAGGTTGCTTCTGTGTCTTGG + Intergenic
1052080186 9:24195976-24195998 CTTAGGTTGTTTCTATGTCTTGG + Intergenic
1052702615 9:31956505-31956527 CTTAGGTTGTTTCCATGTCTTGG - Intergenic
1053291257 9:36880948-36880970 CACAGCTTGTTTCAGTGCCTGGG - Intronic
1055350907 9:75387095-75387117 CTTAGGTTGTTTCTGTATCTTGG - Intergenic
1055460236 9:76512551-76512573 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1055756863 9:79567669-79567691 CTAAGAGTGTGTCTGTGTCTTGG - Intergenic
1056043528 9:82692364-82692386 CTTAGGTTGATTCTGTATCTTGG + Intergenic
1056714273 9:89015109-89015131 CTGAGGTTGTTTAATTCTCTTGG + Intronic
1056999535 9:91494724-91494746 CTTAGGTTGATTCCGTATCTTGG + Intergenic
1057224755 9:93286741-93286763 CTTAGGTTGTTTCCATATCTTGG - Intronic
1057976838 9:99614101-99614123 CTTAGGTTGTTTCTATATCTTGG - Intergenic
1058142225 9:101369122-101369144 GTAAGTTTCTTTCAGTGTGTGGG - Intronic
1059141837 9:111860587-111860609 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1059160635 9:112031831-112031853 CTCAGGTTGATACCGTGTCTTGG - Intergenic
1059235482 9:112757411-112757433 CTTAGGTTGTTTCTATATCTTGG + Intronic
1059435900 9:114276044-114276066 CTAAACTTTTTTCAGTTTCTTGG + Intronic
1059547775 9:115196033-115196055 CTTAGGTTGTTTCCATATCTTGG + Intronic
1059550122 9:115220711-115220733 CCATGGTTGTTTCAGGATCTTGG - Intronic
1059597307 9:115735353-115735375 CTTAGGTTGATTCTATGTCTCGG + Intergenic
1059621975 9:116015962-116015984 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1061098756 9:128476129-128476151 CTTAGGTTGATTCCGTATCTTGG + Intronic
1185764931 X:2717514-2717536 TTAAGGATGTTTCATTTTCTTGG - Intronic
1186654605 X:11599165-11599187 TTAAGGTTGTTTCCATGTCTTGG + Intronic
1187040517 X:15590301-15590323 CTTAGGTTGTTTCCCTATCTTGG + Intronic
1187071194 X:15890152-15890174 CTGAGGTTGTTTCCATATCTTGG - Intergenic
1187148516 X:16659971-16659993 CTTAGGTTGATTCTGTATCTTGG + Intronic
1187440635 X:19315333-19315355 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1187570680 X:20497739-20497761 CTTAGGTTGATTCAATATCTTGG + Intergenic
1187780003 X:22810131-22810153 CTTAGGTTGTTTACGTATCTCGG - Intergenic
1187983588 X:24786123-24786145 CTTAGGTTGTTTCCATATCTTGG + Intronic
1188248525 X:27863085-27863107 CTTAGGTTGAATCTGTGTCTTGG - Intergenic
1188385391 X:29551224-29551246 CTTGGGTTGTTTCCATGTCTTGG + Intronic
1188639339 X:32479826-32479848 TTTAGGTTGTTTCCGTATCTTGG + Intronic
1188767016 X:34106097-34106119 CTAAGGTTGATTCCAAGTCTTGG + Intergenic
1189023730 X:37370249-37370271 CTTAGGTTGATTCTGTATCTTGG + Intronic
1189664800 X:43342636-43342658 ATAAGGTTATATAAGTGTCTGGG + Intergenic
1189722598 X:43935687-43935709 CTTAGATTGTTTCTGTATCTTGG - Intergenic
1189729855 X:44008304-44008326 CTTAGGTTGTTTCCATATCTTGG - Intergenic
1189887799 X:45566642-45566664 CTTAGGTTGTTTCAAAATCTTGG - Intergenic
1190546093 X:51529083-51529105 CTGAGGTTGTTTCCATATCTTGG - Intergenic
1190580945 X:51893042-51893064 CTAACGTTCTTTCTGCGTCTGGG + Intronic
1190717547 X:53116479-53116501 CTATGGTTGTCTCATTCTCTAGG + Intergenic
1191210633 X:57881553-57881575 CTTAGGTTGATTCTGTATCTAGG - Intergenic
1191815847 X:65243700-65243722 CTTAGGTTGATTCCGTATCTTGG - Intergenic
1192500557 X:71647706-71647728 CTTAGGTTGTTTCCATATCTTGG - Intergenic
1192507131 X:71694461-71694483 CTTAGGTTGATTCCATGTCTTGG - Intergenic
1192519566 X:71787085-71787107 CTTAGGTTGATTCCATGTCTTGG + Intergenic
1192762950 X:74114383-74114405 CACAGGTTGTTTCCTTGTCTTGG - Intergenic
1192770433 X:74183631-74183653 CTTAGGTTGTTTCCATATCTTGG - Intergenic
1192805824 X:74507905-74507927 CTTAGGTTGATTCAATATCTTGG + Intronic
1193646499 X:84075610-84075632 TTAAGGTTTTCTCTGTGTCTTGG - Intronic
1193664147 X:84295559-84295581 CTTAGGTTGATTCCGTATCTTGG + Intergenic
1193681493 X:84524989-84525011 CTTACGTTGATTCTGTGTCTTGG - Intergenic
1194036508 X:88880346-88880368 CTTAGGTTGTTTCTGTGTTTTGG + Intergenic
1194142680 X:90223794-90223816 CTTAGGTTGTTTCCATGTCTTGG - Intergenic
1194460703 X:94164114-94164136 CTGAGGTTGTTTCCATATCTCGG + Intergenic
1195680704 X:107543950-107543972 CTTAGGTTGTTTCCCTATCTTGG - Intronic
1195816073 X:108889757-108889779 CTTAGGTTGTTTCTATATCTTGG - Intergenic
1195980364 X:110570746-110570768 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1196087350 X:111698772-111698794 CTTAGGTTGTTTCCTTATCTTGG + Intronic
1196327817 X:114428942-114428964 CTTATGTTGTTTCCGTATCTTGG + Intergenic
1196657632 X:118235595-118235617 CTTTGGTTGTTTCCATGTCTTGG - Intergenic
1196676300 X:118424010-118424032 TTTAGGTTGTTTCCATGTCTAGG + Intronic
1197113815 X:122807658-122807680 TTTAGGTTGTTTCTGTATCTTGG - Intergenic
1197321198 X:125033030-125033052 CTTCGGTTGTTACAGTGACTGGG + Intergenic
1197473692 X:126893975-126893997 CTTAGGTTGTTTCTGTATCTTGG - Intergenic
1197608999 X:128617333-128617355 ATATGGTTGTTTAAGAGTCTGGG - Intergenic
1198792979 X:140365462-140365484 CTTAGGTTGTTTCAATATCTTGG - Intergenic
1199003220 X:142664870-142664892 CTTAGGTTGTGTCTATGTCTTGG + Intergenic
1199050357 X:143229890-143229912 ATTAGGTTGTTTCCGTATCTTGG + Intergenic
1199152823 X:144507980-144508002 CTTAGGTTGTTCCTGTATCTTGG + Intergenic
1199250548 X:145657230-145657252 CTTAGGTTGATTTAGTATCTTGG - Intergenic
1199251635 X:145669439-145669461 CTTAGGTTGTTTCCATATCTTGG + Intergenic
1199416877 X:147595167-147595189 TTTAGGTTGCTTCCGTGTCTTGG + Intergenic
1200328753 X:155271775-155271797 CTTAGGTTGCTTCTGTATCTTGG + Intergenic
1200488435 Y:3792895-3792917 CTTAGGTTGTTTCCATGTCTTGG - Intergenic
1200687666 Y:6271678-6271700 CTCAGGTTGCTTCCGTGTTTTGG + Intergenic
1200791330 Y:7302194-7302216 CTGAGGTTGTTTCCACGTCTTGG + Intergenic
1200795509 Y:7337819-7337841 CTAAGGTTGTATAAGTATCCAGG - Intergenic
1201047604 Y:9903025-9903047 CTCAGGTTGCTTCCGTGTTTTGG - Intergenic
1201321437 Y:12702452-12702474 GTAAGCCTGTTTCAGTGTTTGGG + Intronic
1201785180 Y:17768496-17768518 CTTAGGTTGTTACCGTATCTTGG + Intergenic
1201816373 Y:18137491-18137513 CTTAGGTTGTTACCGTATCTTGG - Intergenic