ID: 1097700006

View in Genome Browser
Species Human (GRCh38)
Location 12:62810240-62810262
Sequence CCTACCCTACTCCAGGATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097700000_1097700006 -5 Left 1097700000 12:62810222-62810244 CCAATAGAATATCATAACCCTAC 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1097700006 12:62810240-62810262 CCTACCCTACTCCAGGATTGGGG 0: 1
1: 0
2: 0
3: 12
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097700006 Original CRISPR CCTACCCTACTCCAGGATTG GGG Intronic
900030183 1:365642-365664 CCCTCCCTGCCCCAGGATTGTGG - Intergenic
904261323 1:29289452-29289474 CCAAGCCTACTGCAGGAGTGAGG - Intronic
904888181 1:33757602-33757624 CCTACCACACTCCAGACTTGAGG + Intronic
906178857 1:43800616-43800638 GCTAGCCTACTTCATGATTGGGG + Intronic
906240751 1:44240827-44240849 CCTACCCTTCTGCAGGGTTCTGG - Intronic
907655120 1:56334276-56334298 CTTACCCTTCTCCAGCAATGAGG + Intergenic
911089945 1:94010321-94010343 CCCACCTTCCTCCAGGAGTGGGG + Intronic
916608671 1:166368132-166368154 CCTTGGATACTCCAGGATTGAGG + Intergenic
920331583 1:205211828-205211850 CCTCCCCTTCTCCAGCCTTGAGG - Intergenic
921331663 1:214044590-214044612 CCTCCCCTTTGCCAGGATTGAGG - Intergenic
922575002 1:226655455-226655477 CCTCCCCTGCCCTAGGATTGAGG - Intronic
1065572004 10:27080830-27080852 ACTACCCAACTCCATGATTTGGG + Intronic
1067045051 10:42980784-42980806 CCTGCCCTCCTCCAGGAGCGGGG - Intergenic
1067082289 10:43218536-43218558 CCTGCCCTGCTGCAGGAATGGGG - Intronic
1069724018 10:70566066-70566088 CCTCCCCTTCCCCAGGATGGTGG + Intronic
1072286124 10:93917250-93917272 CCTCCCCCACTCCAGGATGGAGG - Intronic
1078480559 11:11671915-11671937 CTTACCCTACTCAGGGCTTGAGG - Intergenic
1080385007 11:31805857-31805879 CCTACCCTGCTGCAGGCCTGGGG + Intronic
1080594462 11:33757913-33757935 GCTACTATACTCCAGGCTTGGGG + Intronic
1084569981 11:69953533-69953555 CCTTCCCTCCACCAGGATTCAGG - Intergenic
1088576099 11:111272741-111272763 CCTACTCTGCACCAGGATTGTGG - Intronic
1089500920 11:118930681-118930703 CCTACCCTCCTCCAGGTGTTTGG - Intronic
1089784923 11:120901027-120901049 CCTGCCCTAATCCAGGATCGGGG + Intronic
1091173061 11:133535306-133535328 CCAACCCCACTCCAGGAAAGAGG + Intergenic
1096503279 12:52078445-52078467 CCTACCCTGCTCCAGGACCATGG - Intergenic
1097700006 12:62810240-62810262 CCTACCCTACTCCAGGATTGGGG + Intronic
1099708430 12:86187482-86187504 CCTACATTACTCCAAGAATGTGG + Intronic
1101230505 12:102736539-102736561 CCTAACTTATTCCAGGAGTGGGG - Intergenic
1101302036 12:103493002-103493024 ACTACCTTAATCCAGGATTAAGG + Intronic
1101932110 12:109023193-109023215 CCCACCTGACACCAGGATTGAGG - Intronic
1103065671 12:117895317-117895339 CTTACCCTACTCCAGGCTCTGGG + Intronic
1108185948 13:47888505-47888527 TCAACCCTACTCTGGGATTGGGG + Intergenic
1116717745 14:48449096-48449118 ACTACCCTACCCCAGCTTTGTGG - Intergenic
1116939216 14:50773799-50773821 CCTTCCCTATTACAGGATAGGGG - Intronic
1118874490 14:69772086-69772108 CGTAACCAACTCCAGGATTCTGG - Intergenic
1119024564 14:71142265-71142287 CCTACCCAACTGCCTGATTGGGG + Intergenic
1120108395 14:80523106-80523128 CCTTCCCTACACCAGCAGTGTGG + Intronic
1120427045 14:84361565-84361587 CCTACTATACTCCTGGACTGTGG + Intergenic
1120652584 14:87151947-87151969 CCTTCCCTACTCTAGGATGATGG - Intergenic
1121996153 14:98604918-98604940 CCTACTCTGCTCCAGGATGTAGG - Intergenic
1122346943 14:101066640-101066662 CCCACCCGCCTCCAGGATGGAGG - Intergenic
1122589790 14:102840066-102840088 CTTACCCTAGTCCTGGGTTGGGG - Intronic
1125503937 15:40256011-40256033 CCTACTCTACTCCAGGCTCTGGG - Intronic
1127931458 15:63600100-63600122 CCTACCCTTTTCCAGGCTGGTGG + Intronic
1130191334 15:81738892-81738914 CCAAGTCTATTCCAGGATTGGGG - Intergenic
1132403543 15:101528629-101528651 CCTACCCTGCTCCAGAATCACGG + Intergenic
1133667019 16:7978552-7978574 CTTATCCTGTTCCAGGATTGGGG + Intergenic
1133873606 16:9712462-9712484 CCCACCCTTCTCCAACATTGAGG + Intergenic
1136229211 16:28877108-28877130 CCACCCCTGCTCCAGGATGGGGG - Intergenic
1138331977 16:56222626-56222648 ACAGCCCTACTCCAGGCTTGAGG + Intronic
1138408572 16:56819582-56819604 ACCACCCTACTCCAGGCTGGAGG - Intronic
1141186431 16:81790772-81790794 CCCTCCCTACTCCAGGGTAGGGG + Intronic
1141638402 16:85327902-85327924 GCCCCCCTACTCCAGGAATGTGG - Intergenic
1142231425 16:88901925-88901947 CGTGCCCCACTCCAGGCTTGAGG + Intronic
1142968821 17:3597548-3597570 CAACCCCTACTCCAGGTTTGGGG - Intergenic
1143362285 17:6381985-6382007 CCTGCCCAACTCCAAGATTTTGG + Intergenic
1147375742 17:40021671-40021693 CCTCCCTTACCCCAGGGTTGAGG - Intronic
1147528153 17:41247060-41247082 ATTACCCTACTTCAGGAATGAGG + Intronic
1147538389 17:41335432-41335454 CCCACCCTGCTCCAGGGTTGGGG - Intergenic
1152949575 17:83220915-83220937 CCCTCCCTGCCCCAGGATTGTGG + Intergenic
1159020885 18:63142210-63142232 CATACCCTCCTCCAGGTCTGAGG - Intronic
1159093937 18:63880927-63880949 CTTACCCTAATCCAGGAGTGGGG + Intronic
1160044454 18:75373637-75373659 CCTACCCACCTCCAGCATTGTGG + Intergenic
1160440223 18:78883944-78883966 CCAACCCCACTGCAGGCTTGGGG + Intergenic
1160805218 19:989625-989647 CCTGCCCTGCCCCAGGACTGCGG - Intronic
1167967121 19:53157058-53157080 CCTACCCTATTCCAGGAAAAGGG + Intronic
1168712649 19:58510833-58510855 CCTCCCCTACACCAGGGGTGGGG - Exonic
925535909 2:4916370-4916392 CCTACCCTGCTCCAGGAAATTGG - Intergenic
926930867 2:18039603-18039625 CACACACTGCTCCAGGATTGGGG - Intronic
927982180 2:27380933-27380955 CCTGCCCGACTCCAGGCTTCAGG + Intergenic
928206471 2:29288152-29288174 CCTGCACTACTCCAGGACTAGGG + Intronic
932447268 2:71788523-71788545 CCTCCCCTCCTCCAGGATCTGGG + Intergenic
932758528 2:74424958-74424980 CCTACCCAAATCCTGGAATGCGG - Exonic
934754374 2:96815659-96815681 CGTACCCTACTAGAGGTTTGGGG - Intergenic
939664578 2:144935265-144935287 CCTACATTACACCAGGATTATGG - Intergenic
1176524122 21:7852389-7852411 ACTACCCTCCTCCAGGGTGGGGG - Intergenic
1178640746 21:34343154-34343176 GCTGCCCTACTTCAGGACTGTGG - Intergenic
1178658142 21:34482402-34482424 ACTACCCTCCTCCAGGGTGGGGG - Intergenic
1178697546 21:34807576-34807598 CCTACCTTCCTCCAGGATGAAGG - Intronic
1181669650 22:24420235-24420257 CCTCCCCAGCTCCAGGATTCCGG - Intronic
1181711653 22:24695331-24695353 CCTACCCTCCACCAGGGTTGTGG - Intergenic
1182964508 22:34508639-34508661 TCTACCTTACCCAAGGATTGAGG - Intergenic
949661229 3:6281352-6281374 CCTACCCTTCTCCAAGACCGTGG + Intergenic
955708538 3:61754339-61754361 CCTACTCTACTCCAGGGTGGAGG - Intronic
961161540 3:124730743-124730765 CCGACCCTACTCTTGGTTTGGGG + Intronic
963493686 3:146033481-146033503 CCTCCCCTTCTCCATGACTGTGG - Intergenic
967299907 3:188002713-188002735 TCTGCTCCACTCCAGGATTGAGG + Intergenic
967311149 3:188107487-188107509 CCTACCTTACAGCAGGAGTGGGG - Intergenic
968885909 4:3332038-3332060 CCTGCCCTATTCCAGGACGGTGG - Intronic
970620107 4:17809786-17809808 CCTACGCTACTCAAGAAATGGGG + Intronic
970638901 4:18041470-18041492 CCCACCCTACTCCAGCATGGGGG + Intergenic
986811016 5:11359916-11359938 TCTCCTCTACTCCAGGCTTGTGG - Intronic
990400097 5:55429449-55429471 CTTACCCTTCTCCAGCATGGGGG - Intronic
992040916 5:72830776-72830798 TCAACCCTCCTCCAGGATTTAGG + Intronic
1000602599 5:163292958-163292980 CCTAACCTACTCTAGGAAAGGGG + Intergenic
1001521225 5:172394971-172394993 CCTGTCCAACTCCAGGATTCTGG + Intronic
1002743806 5:181454730-181454752 CCCTCCCTGCCCCAGGATTGTGG + Intergenic
1004780703 6:18905514-18905536 TCTACCCTACTCCAGGCATTGGG + Intergenic
1007920835 6:45608140-45608162 ACTAACCTACTCCTGGTTTGGGG + Intronic
1015957625 6:138614925-138614947 CCCACCCTACCCCAGGTCTGTGG + Intronic
1018552573 6:165014995-165015017 TCTACCCTAGTCCACGATTAGGG + Intergenic
1019248665 6:170727959-170727981 CCCTCCCTGCCCCAGGATTGTGG + Intergenic
1019478998 7:1257447-1257469 CCCACCCTACTGCAGGATAGGGG + Intergenic
1022192087 7:28026293-28026315 CCTACCCTGCTCCAAGGTTTAGG - Intronic
1027811490 7:82905774-82905796 CCTACCCAACTGCTGCATTGAGG - Intronic
1039860409 8:41452752-41452774 CTTACCCTACTCCAGGGATATGG - Intergenic
1043969696 8:86515170-86515192 GGTTCCCTACACCAGGATTGTGG + Intronic
1045008110 8:97933535-97933557 CCTATTCGACACCAGGATTGCGG - Intronic
1046862176 8:119105873-119105895 CCTAACCCACTGCAGGATTCGGG + Exonic
1051579300 9:18653441-18653463 ACTGCCCTACTCAAGGGTTGTGG + Intronic
1052740364 9:32386421-32386443 CCTACCACACTCCAGGATGGTGG - Intronic
1053562308 9:39209538-39209560 CCCACCCTTCTCCAGGCTGGAGG - Intronic
1053828113 9:42047526-42047548 CCCACCCTTCTCCAGGCTGGAGG - Intronic
1054134808 9:61409420-61409442 CCCACCCTTCTCCAGGCTGGAGG + Intergenic
1054602444 9:67139920-67139942 CCCACCCTTCTCCAGGCTGGAGG + Intergenic
1054780350 9:69160470-69160492 CCTTCACTACTCTAGGAATGTGG + Intronic
1055107513 9:72527969-72527991 CCTCCCCGACTCCAGAATTTAGG + Intronic
1056125929 9:83536968-83536990 CCTACCCTAGTCGAGTCTTGAGG - Intronic
1056501064 9:87209846-87209868 CCCACTCTAGTCCAGGAGTGTGG - Intergenic
1058510670 9:105713395-105713417 CCAACCTTGCTCCAAGATTGGGG - Intronic
1060948658 9:127586602-127586624 CCAGCCCTGCTCCAGGATTCAGG + Intergenic
1061540983 9:131277701-131277723 CCCACCCTCCTCCCGGCTTGGGG + Intergenic
1203609624 Un_KI270748v1:85223-85245 CCCTCCCTGCCCCAGGATTGTGG + Intergenic
1188166374 X:26869712-26869734 CCGGCCCCACTCCAGCATTGGGG + Intergenic
1191098970 X:56704775-56704797 CCTCCCCTCCTCCAGGCTGGAGG + Intergenic
1193083520 X:77428006-77428028 CCTTCCCTCCTCCAGGATAGTGG - Intergenic
1194247581 X:91534934-91534956 CCTCCCCCACCCCAGGCTTGGGG - Intergenic
1194489633 X:94530511-94530533 CCTACCAAACTCCTGGGTTGGGG + Intergenic
1195114940 X:101687848-101687870 CCTTCCCTGCTACAGGAGTGAGG - Intergenic
1200566603 Y:4776467-4776489 CCTCCCCCACCCCAGGCTTGGGG - Intergenic
1201650872 Y:16284447-16284469 CCTTCCCGCCTCCAGGACTGTGG - Intergenic