ID: 1097701800

View in Genome Browser
Species Human (GRCh38)
Location 12:62827931-62827953
Sequence TCGACTCAGCATTAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097701794_1097701800 -7 Left 1097701794 12:62827915-62827937 CCAGTGATCTCCCCAATCGACTC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1097701800 12:62827931-62827953 TCGACTCAGCATTAGGAGGATGG 0: 1
1: 0
2: 0
3: 3
4: 67
1097701793_1097701800 -1 Left 1097701793 12:62827909-62827931 CCACTGCCAGTGATCTCCCCAAT 0: 1
1: 0
2: 2
3: 19
4: 151
Right 1097701800 12:62827931-62827953 TCGACTCAGCATTAGGAGGATGG 0: 1
1: 0
2: 0
3: 3
4: 67
1097701792_1097701800 10 Left 1097701792 12:62827898-62827920 CCATTGTAGTACCACTGCCAGTG 0: 1
1: 0
2: 1
3: 9
4: 91
Right 1097701800 12:62827931-62827953 TCGACTCAGCATTAGGAGGATGG 0: 1
1: 0
2: 0
3: 3
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097701800 Original CRISPR TCGACTCAGCATTAGGAGGA TGG Intronic
903557524 1:24204409-24204431 CAGACTCAGAATGAGGAGGAAGG - Intergenic
905525546 1:38635916-38635938 TCCAGTCAGCAGTAGGAAGATGG + Intergenic
907060763 1:51421921-51421943 GCGATTCAGGATTAGGAGGATGG - Intronic
909692555 1:78425053-78425075 TGGATTCAGCTGTAGGAGGAGGG + Intronic
913615315 1:120553846-120553868 TTGACTCAGAATTAGGACAAAGG + Intergenic
914574962 1:148957062-148957084 TTGACTCAGAATTAGGACAAAGG - Intronic
915027072 1:152841179-152841201 TGCACTAAGCATTAGCAGGAAGG - Intergenic
915691369 1:157694573-157694595 AGGGCTCAGCATTTGGAGGATGG - Intronic
918393616 1:184091958-184091980 TCGACTCAGCAGTTGGATGGTGG + Intergenic
918468106 1:184842422-184842444 TCTACCCAGCATTAGGAGAGTGG + Intronic
1064682875 10:17828974-17828996 TGGAGCCAGCATCAGGAGGAGGG - Intronic
1064768458 10:18698711-18698733 TACAAGCAGCATTAGGAGGATGG - Intergenic
1069892888 10:71662888-71662910 TCCGCTCAGCCTGAGGAGGAAGG - Intronic
1071891161 10:90009068-90009090 TTGTCTCAGCACTAGGAAGAAGG + Intergenic
1076659115 10:132043695-132043717 TGGACACAGCATGACGAGGAGGG + Intergenic
1078081354 11:8206880-8206902 TCGCTCCAGCATTAGCAGGAGGG - Intergenic
1079243006 11:18733803-18733825 AGGACTCAGGATGAGGAGGAGGG + Intronic
1088853002 11:113720769-113720791 TCGAGGCAGCACTAGGGGGATGG + Intergenic
1092067112 12:5599916-5599938 CCGTCTCAGCATTGGCAGGAAGG - Intronic
1097701800 12:62827931-62827953 TCGACTCAGCATTAGGAGGATGG + Intronic
1101549226 12:105746613-105746635 GCACCTCAGCATTAGGAGTAAGG - Intergenic
1103141165 12:118549619-118549641 TCGACTCTGCAGAAGGAGGTGGG + Intergenic
1103282581 12:119772112-119772134 AAGACCCAGCAATAGGAGGAGGG + Intronic
1107789386 13:43986329-43986351 TCTACTCAGCAATAAGAAGAGGG + Intergenic
1113010333 13:105757907-105757929 TGGGATCTGCATTAGGAGGAAGG - Intergenic
1115791290 14:36881810-36881832 CCGTTTCAGCAATAGGAGGAAGG + Intronic
1116116363 14:40656716-40656738 TGGACTGAGCATTAGGAGCTTGG - Intergenic
1118720770 14:68592096-68592118 TCCCCTCAGTATTAGGAGGGGGG + Intronic
1125735604 15:41923317-41923339 CCTATTCAGCCTTAGGAGGAGGG - Intronic
1134095020 16:11413368-11413390 TCCACTCTGCTGTAGGAGGAGGG - Intronic
1138800733 16:60025341-60025363 TCAACTCACCAATAGGAGAAAGG + Intergenic
1141482296 16:84314506-84314528 TCCTCTCAGCCTTGGGAGGAGGG - Intronic
1142329964 16:89445526-89445548 TAGCCTGAGCATTTGGAGGACGG - Intronic
1143936578 17:10491982-10492004 TTTACTCAGCCTTAGGATGAAGG + Intergenic
1144009991 17:11138253-11138275 ATGACTCAGCAATAGGAGAAAGG + Intergenic
1144021953 17:11245540-11245562 TCAACTCAGGGTGAGGAGGAAGG - Intronic
1144998162 17:19285340-19285362 TGGACTCGGTATGAGGAGGAGGG - Intronic
1157101603 18:44735246-44735268 TTGGCTCTGCATTAGGAGGCAGG + Intronic
1157112111 18:44830945-44830967 TCCACAAAGCATTGGGAGGATGG + Intronic
1161809000 19:6460638-6460660 TCGATCCACCATTAGGGGGAAGG + Intronic
1163813882 19:19452032-19452054 AAGACTCAGAAGTAGGAGGAGGG + Intronic
1167597029 19:50433144-50433166 TCGACTCTGCATGGGGAAGAGGG + Intronic
1171489295 20:25505130-25505152 ACGACTCAGCCTTAGAAAGAAGG + Intronic
1174554865 20:51386823-51386845 TCGTCTCAGCCCTAGGAGGTAGG - Intergenic
1181393435 22:22600530-22600552 TCTACTCAGGATGATGAGGAGGG - Intergenic
1181619325 22:24077751-24077773 CCCAATCAGCATAAGGAGGATGG - Intronic
1183251196 22:36731687-36731709 TGGACTGAGCATGAGGAGGATGG - Intergenic
953472509 3:43179170-43179192 CCGAGTCAGCATTACGAGGCAGG + Intergenic
962200645 3:133398829-133398851 TCAACTCAACCTCAGGAGGAAGG - Intergenic
969455375 4:7297139-7297161 TCTCCTCTGCATTAGGTGGAGGG + Intronic
970153379 4:13115406-13115428 TCCATACAGCATTTGGAGGAAGG - Intergenic
977362882 4:96028979-96029001 ACGAAACAGTATTAGGAGGATGG + Intergenic
979689620 4:123546857-123546879 TCGAGTGAGCAATAGGATGAAGG - Intergenic
984212555 4:176868411-176868433 TAGAACCAGCATTAGGAGAAGGG + Intergenic
995029163 5:107460233-107460255 TCGTCTCATCAATATGAGGATGG - Intronic
1001404929 5:171469515-171469537 TTGACTCAGCCTGGGGAGGAAGG - Intergenic
1012374608 6:98546669-98546691 TCCACTCAGCCTTTGGAGCAAGG + Intergenic
1013564101 6:111339914-111339936 TTGACAAAGCATTAGGAGGATGG - Intronic
1018924661 6:168197858-168197880 TGGACTCAGCAGGATGAGGAAGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023512831 7:40971255-40971277 CCCACTCAGCATGAAGAGGATGG + Intergenic
1030235995 7:107262719-107262741 TCAACTGAGAATAAGGAGGAGGG - Intronic
1035847666 8:2882662-2882684 CCCACTCAGCAGAAGGAGGATGG - Intergenic
1036734678 8:11301346-11301368 TCAACTGAGCATTAAGGGGAAGG - Intronic
1040003083 8:42595636-42595658 TCCACTAAGCTTCAGGAGGAAGG + Intergenic
1041076545 8:54175039-54175061 TGGACTCCGCATAACGAGGACGG - Intergenic
1059043942 9:110843873-110843895 TCGACACAGCTGGAGGAGGAGGG - Intergenic
1060126467 9:121052596-121052618 TTGAGGCAGCATTAGCAGGAAGG - Intergenic
1186226709 X:7406838-7406860 ACGAGACAGCATTAGGGGGATGG + Intergenic
1191781585 X:64873912-64873934 ATGACTCAGTATTTGGAGGAAGG + Intergenic
1193368065 X:80658757-80658779 TCTATTCTGCTTTAGGAGGAAGG + Intergenic