ID: 1097703469

View in Genome Browser
Species Human (GRCh38)
Location 12:62844229-62844251
Sequence AGGCAGAAACAGTTTTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097703466_1097703469 9 Left 1097703466 12:62844197-62844219 CCAAAGTGGGGAAGCTAAGGTTT 0: 3
1: 1
2: 14
3: 37
4: 187
Right 1097703469 12:62844229-62844251 AGGCAGAAACAGTTTTAGCAGGG 0: 1
1: 0
2: 0
3: 20
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097703469 Original CRISPR AGGCAGAAACAGTTTTAGCA GGG Intronic
900635407 1:3662438-3662460 AGGCTGAACCAGCTATAGCAGGG + Intronic
902914842 1:19631033-19631055 ATGAAGAAACAGTTTTTGGAAGG + Intronic
903482490 1:23664201-23664223 AGCTAGAAGCAGTTTTAGCTGGG + Intergenic
903490282 1:23723123-23723145 GGGCAGAAACAGGTTTAGGGAGG + Intergenic
904482802 1:30804796-30804818 AGGCAGGTAAAGTCTTAGCACGG + Intergenic
905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG + Intronic
907435176 1:54441098-54441120 TGGCAGAAACAGTTCTTCCAGGG - Intergenic
908597886 1:65708167-65708189 TGGCAGACACAGTTTTATCCAGG - Intergenic
908993751 1:70127170-70127192 AAGCAGAAACAGTTTTATAAAGG - Intronic
910903479 1:92148258-92148280 CGGCAGAAACATTATGAGCAAGG - Intergenic
911842265 1:102698129-102698151 AGGGAGAAACAGTGTTGGAAAGG - Intergenic
912121819 1:106480431-106480453 AGGCAGAAAAAGCTTATGCAGGG - Intergenic
913017347 1:114752479-114752501 AGTCAGAAACACTTGGAGCAGGG - Intronic
915126514 1:153669397-153669419 ATACAGAAACAGTGTAAGCATGG - Intronic
916976634 1:170087406-170087428 CAGCATAAACATTTTTAGCAAGG + Intergenic
917249211 1:173038926-173038948 AGGCAAAAACAGTGTGAGAAGGG + Intergenic
918560961 1:185867184-185867206 TGGAAGAAACAGTTTTAGAGAGG + Intronic
918602792 1:186383322-186383344 AGGAAGAAACAGATTTGGGATGG + Intronic
919163585 1:193863507-193863529 AGGCAAAAAGAGTTTGTGCAGGG - Intergenic
919305890 1:195837367-195837389 AGCTAGAAACAGTTTTAAGAAGG - Intergenic
920202531 1:204268384-204268406 AGGGAGAAGCAGCTCTAGCAGGG - Intronic
920896878 1:210060038-210060060 ATGCTGAAACAGATGTAGCAAGG - Intronic
920961886 1:210671011-210671033 AGGCATAGACATGTTTAGCACGG - Intronic
921232057 1:213083110-213083132 ATGCAGAAACATTGTTAGCTTGG + Intronic
922469456 1:225866928-225866950 AGGCAGACACTGTTTTGCCAGGG - Intronic
924161524 1:241237909-241237931 AGGCAAAACCAGATTTATCAGGG + Intronic
924607582 1:245548377-245548399 AGGCAGAAACAGTGAAAACATGG + Intronic
1063061914 10:2564535-2564557 AGGTAGAAACATTTTTAGAAAGG - Intergenic
1065187902 10:23187245-23187267 AGGTGGAAACAGATTTAGAAAGG - Intergenic
1065882153 10:30046196-30046218 AGGCAAACACAGTGTTAGGAAGG + Intronic
1066684873 10:37971378-37971400 AGGCAGTAACCTATTTAGCATGG + Intronic
1067908572 10:50320542-50320564 AGCCAGGAAAAGTTTTAGCAGGG - Intronic
1068438324 10:57019192-57019214 AGTCAGAAAGAGCTGTAGCAGGG - Intergenic
1069084887 10:64127246-64127268 AAGAAGAAATAGTGTTAGCAAGG + Intergenic
1069344536 10:67452636-67452658 AGGCAGAAAAAGTTTTTCAATGG + Intronic
1071666392 10:87562960-87562982 AGACAGAAAATTTTTTAGCAAGG - Intergenic
1071867445 10:89750745-89750767 GGCCAGAAACAATTTTAGGAAGG + Intronic
1075581549 10:123622580-123622602 ATGCAGAAACAATTTAAGTAAGG - Intergenic
1075867041 10:125732256-125732278 AGGCAGATAAAGCGTTAGCAAGG + Intronic
1078204808 11:9219312-9219334 AGGAAGAAACAAATTTACCAAGG + Intronic
1078243446 11:9551480-9551502 GGGCAGAAACAGTTACAGCTTGG + Intergenic
1079834833 11:25321840-25321862 AGGCAAAAACAGACTTAGCTAGG + Intergenic
1079995509 11:27291316-27291338 AAGCATAAACAGTTTTGACATGG + Intergenic
1083193198 11:61067472-61067494 AGCCAGAAACAGTTTTGCCTGGG + Intergenic
1084849345 11:71926372-71926394 TGGCAGCAACAGTTTTTGTAAGG - Intronic
1086025544 11:82286172-82286194 AGGTTGAAATAGTTTTTGCAAGG - Intergenic
1086378996 11:86232195-86232217 AGGAAGAAACAGATTTAATAAGG - Intergenic
1087149411 11:94845192-94845214 TCACAGAAACAGTTTCAGCAGGG + Intronic
1090097579 11:123758028-123758050 AGGCAGCAACAGTGTCTGCAGGG + Intergenic
1090440728 11:126723254-126723276 AGACAGACACACTTTTAGTAGGG + Intronic
1091064123 11:132492555-132492577 AGGAAGAAACAGGTTGAGAAGGG + Intronic
1092658232 12:10710137-10710159 ATTCAGAAGAAGTTTTAGCAAGG + Intronic
1093335273 12:17897837-17897859 AGGGAGAAACACTTTTGCCAGGG + Intergenic
1093476321 12:19558719-19558741 TGGCACACACATTTTTAGCATGG - Intronic
1093879523 12:24388043-24388065 AGGCAGAAATAGAGTTTGCAAGG + Intergenic
1095516310 12:43009836-43009858 TGGTAAAAACAGATTTAGCATGG - Intergenic
1096110142 12:49023863-49023885 AGGCAGAATCTGTGGTAGCAGGG - Intronic
1097142371 12:56912892-56912914 AGGCAGCAACTGTTTTAGAAGGG - Intergenic
1097703469 12:62844229-62844251 AGGCAGAAACAGTTTTAGCAGGG + Intronic
1101322923 12:103689132-103689154 CTGCAGGAACAGTTTCAGCATGG - Intronic
1101634186 12:106523663-106523685 AGAAAGAAAGAGATTTAGCAAGG + Intronic
1102735955 12:115159662-115159684 ACGAAGAAACAGTGATAGCAAGG - Intergenic
1102746865 12:115256610-115256632 ATGCAAAAACAGGTTGAGCAGGG + Intergenic
1107484937 13:40817043-40817065 AGGCAGAATCACTTTTACCCAGG + Intergenic
1107934464 13:45333863-45333885 AGGTGGAAAAAGTTTTAGGAAGG - Exonic
1108066809 13:46586356-46586378 AGCCAGAAACAGCCATAGCAAGG + Intronic
1109471216 13:62806828-62806850 AGGCTGAAACAATTTGAGCAAGG + Intergenic
1110519245 13:76456004-76456026 AGGGAGAACCAGCTTTAGCCTGG + Intergenic
1110534884 13:76639496-76639518 GAGCAGTAACAGTTTTAGAAAGG - Intergenic
1110929523 13:81197146-81197168 AGGTAGAAAAATTTTTAGAATGG + Intergenic
1112654191 13:101432292-101432314 AGGCGGAAACAGCATTAACATGG - Intergenic
1113971151 13:114190429-114190451 AGGAATAAACAATTATAGCAAGG + Intergenic
1114465773 14:22921446-22921468 AGGCTGAAGCAGTGTAAGCAAGG + Intronic
1114746609 14:25155166-25155188 TGTCAGAAACATTTTTAGGAAGG - Intergenic
1115075644 14:29386750-29386772 TGGTAGAATGAGTTTTAGCATGG + Intergenic
1115458944 14:33637022-33637044 AGGCAGAGACATTTTTTTCATGG + Intronic
1116017955 14:39429995-39430017 AGGCACATACAGTGTTTGCATGG + Intronic
1117091352 14:52253851-52253873 AGGAAGAAACTGGTCTAGCAAGG + Intergenic
1118597346 14:67446128-67446150 AGGCAGGACCAGTTTTAGCTTGG + Intergenic
1122277088 14:100597339-100597361 AGGCAGAAATAATTTGATCAAGG - Intergenic
1122739906 14:103866288-103866310 AAGAAGGAACAGCTTTAGCAGGG + Intergenic
1123504601 15:20928012-20928034 AGGCAGAAACAAGTCTAACAAGG + Intergenic
1123561850 15:21501713-21501735 AGGCAGAAACAAGTCTAACAAGG + Intergenic
1123598092 15:21938994-21939016 AGGCAGAAACAAGTCTAACAAGG + Intergenic
1125443390 15:39727351-39727373 TGGCAGCAACAATTTTAACAAGG + Intronic
1126585768 15:50284441-50284463 AGGGAGATTCAGTTTTAGCTTGG - Intronic
1126861261 15:52885207-52885229 AGGGAGAAACAGATTTGGAATGG - Intergenic
1202970193 15_KI270727v1_random:228839-228861 AGGCAGAAACAAGTCTAACAAGG + Intergenic
1132593619 16:737938-737960 AGGCAGGAATGGTTTGAGCAGGG + Intronic
1133894125 16:9909155-9909177 AGGCAAAAAGAGTTTGTGCAGGG + Intronic
1135741479 16:24979101-24979123 AGGCAGAAATAAATTTAGAAGGG + Intronic
1136011514 16:27366542-27366564 ATGGAGAAACAGTTTTAGAGAGG + Intergenic
1137502230 16:49020231-49020253 AGTCAGAAACAGTTTATGCAAGG - Intergenic
1137573413 16:49581497-49581519 AGGCATTAACAGTTTTTGCTAGG + Intronic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1140189862 16:72806164-72806186 ATACAGAAGCAGTTTTAGAAAGG - Intronic
1140358247 16:74323886-74323908 AGGCAGAAAGAGCTTAACCAAGG + Intergenic
1141044790 16:80706427-80706449 AGGCAAAAATAGTTTGATCATGG - Intronic
1142148020 16:88500583-88500605 TGGCAGCAACAGTCCTAGCAAGG - Intronic
1142575205 17:902423-902445 AGGCAGAAACAGATTTACTAGGG + Intronic
1143653130 17:8276699-8276721 AGGCAGAAACAGTGCTAGCTCGG + Intergenic
1149044854 17:52233097-52233119 AGGCTAGAATAGTTTTAGCAAGG + Intergenic
1150662036 17:67090501-67090523 AGGCCCAAATGGTTTTAGCATGG - Intronic
1152526508 17:80890998-80891020 AGGCAGAAAAAGTTGTCGTAGGG + Intronic
1153132825 18:1876995-1877017 ACTCAGAAACACTTTCAGCAAGG + Intergenic
1154146645 18:11872318-11872340 TGGCAGAAAAAGTCTTGGCAGGG + Exonic
1155093692 18:22535735-22535757 AGGCATAACTAGTTTAAGCAAGG + Intergenic
1156511525 18:37640948-37640970 AGGCAGAAAAACTCGTAGCATGG + Intergenic
1157835236 18:50895689-50895711 AGGCTGCAACAGTTTTAAAAAGG - Intronic
1157848127 18:51022815-51022837 AAGAAGAAACAGTTTTAGCCAGG - Intronic
1158075810 18:53527598-53527620 AGACAGAAAAAGTTTTACTAAGG + Intronic
1158312392 18:56171902-56171924 AGGCAAAAACAGGTTGGGCATGG - Intergenic
1159634933 18:70793717-70793739 AGGAAGCAACATTTTCAGCAAGG - Intergenic
1160178501 18:76614784-76614806 AGGCAGAAGCAGTCTTAAAAAGG + Intergenic
1162023350 19:7879032-7879054 GGGCAGAATCAGTTAGAGCAGGG + Intergenic
1163324748 19:16596174-16596196 AGCCAAAAACAGTTGAAGCATGG - Intronic
1163785187 19:19271295-19271317 AGGAAGAAACAGCCTGAGCAAGG - Intronic
1166906705 19:46115487-46115509 AGGCAGAAACAGCTACAGCTTGG + Intergenic
1167029203 19:46945979-46946001 AGGGAGAAACAGTTTTACTGGGG + Intronic
926874675 2:17462112-17462134 AGGCAGTAACTGTGATAGCATGG + Intergenic
928365884 2:30702205-30702227 GGGCAGAAACAGTATTTGTAAGG - Intergenic
929253267 2:39781677-39781699 CGGCAGGAACAATTTTAGAATGG + Intergenic
930887633 2:56345799-56345821 AGTTAGAAACAGTTTCTGCAGGG - Intronic
932497733 2:72154861-72154883 TGGCAGTAACAGTTTTTGAAAGG + Intergenic
933295713 2:80488646-80488668 AGGAAGAAACTGTATTAGAATGG - Intronic
936522979 2:113223533-113223555 AGGCAGGAACTAGTTTAGCATGG - Intronic
936969148 2:118159769-118159791 TGGCAAAACCAGTTTTAACAGGG + Intergenic
938746930 2:134288265-134288287 AGGCAGAAACAGGTCTTGAATGG - Intronic
940279782 2:151977195-151977217 AGTCAGAAACACATTTAACAGGG - Intronic
941173219 2:162164783-162164805 AGACAGAAACAGAATAAGCATGG + Intergenic
942827837 2:180201791-180201813 AGGCAGAAAATGATTTTGCAGGG + Intergenic
945958328 2:216106930-216106952 TGGCTGAAACATTTTTAGGAAGG - Intergenic
946641622 2:221789829-221789851 AAGGAGAAATAGTTTTAGGATGG - Intergenic
948265381 2:236632078-236632100 AGGCAGAGCCAGTTCAAGCAGGG + Intergenic
1168789710 20:567992-568014 AAGCAGAAACTGATTTGGCAGGG - Intergenic
1168939021 20:1693442-1693464 AGGCAGAAAGAGTTGAAGGAGGG + Intergenic
1172004145 20:31806171-31806193 AGGAAGAAACAGTCTCTGCAAGG - Intergenic
1173701947 20:45080136-45080158 AACCAGATACAGTTTTTGCAGGG + Intergenic
1176378110 21:6096782-6096804 AGGGAGAAGCAGTGTTACCAGGG + Intergenic
1178026660 21:28475958-28475980 TGGAATAAACATTTTTAGCAAGG - Intergenic
1179745363 21:43441464-43441486 AGGGAGAAGCAGTGTTACCAGGG - Intergenic
1180060657 21:45383358-45383380 AGCCAGGATCAGCTTTAGCAGGG - Intergenic
1180717473 22:17881557-17881579 AGGGAGCAACAGTTTTCTCAGGG + Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1184095470 22:42314081-42314103 AGGCAGATACAGGCTCAGCAGGG + Intronic
949929049 3:9064174-9064196 AGGCCTAACCAGTGTTAGCACGG + Intronic
951093620 3:18602618-18602640 AGGCAGAAAATATTTTAGAAGGG + Intergenic
951170071 3:19531553-19531575 GGGCAGAAATAGTTTTGGCCTGG + Intronic
951346133 3:21548254-21548276 AGGTAGAAACAGTATCAGCCAGG - Intronic
954602881 3:51884711-51884733 AGATAGAAACAGATTTATCATGG + Intergenic
955555549 3:60133379-60133401 AGGCAGGAGAAGTTTTGGCAGGG - Intronic
956875411 3:73458004-73458026 AGGCAGCAGCAGTTCTACCAGGG + Intronic
957159775 3:76595690-76595712 AGGCAGAAAAACTTTTTTCAGGG - Intronic
957736457 3:84210307-84210329 AGTCAGAGAAAGTTTTTGCAGGG + Intergenic
959944743 3:112114812-112114834 AGCCAGTAACAATTTTTGCAAGG - Intronic
959974836 3:112447114-112447136 AGACACAAACAGATTTAGTAAGG + Intergenic
961947135 3:130703283-130703305 AGGAAGAAACATGTTTGGCATGG - Intronic
962952091 3:140228756-140228778 AGGCAGAGAGAGTTTGTGCAGGG + Intronic
963091159 3:141485394-141485416 AAACAGAAACAGGTTTAGGAAGG + Intergenic
963650945 3:147979315-147979337 AGCCAGAAACAGTTTCAGTCAGG + Intergenic
965215253 3:165855364-165855386 AGGAAGAAACAGGTTTTTCAGGG - Intergenic
970729437 4:19085811-19085833 AGGCAGAAATAGCTTAAGAAGGG - Intergenic
971348076 4:25829910-25829932 AAGCAGAAAGAGTTTGTGCATGG + Intronic
971915081 4:32859392-32859414 TGGGAGAAAAAGTTTTATCATGG - Intergenic
971933843 4:33120513-33120535 AGAGAGATACAGTTATAGCATGG + Intergenic
972583575 4:40416581-40416603 AGGGAGATAGAGTTTTAGAAAGG + Intergenic
972822866 4:42722441-42722463 AGGCAGAAAATGTTTTGGAATGG - Intergenic
973558977 4:52114907-52114929 AGGCAGCATCATTTTTAGCTTGG + Intergenic
973667368 4:53176651-53176673 AGACAGAAACAGGTTTTGGATGG + Intronic
978270819 4:106887910-106887932 ACACAGAAACAGTTTTAGAAAGG + Intergenic
978395420 4:108273979-108274001 AGGCAAAACCAATTTAAGCAAGG + Intergenic
980441056 4:132845463-132845485 AGGAAAAAGCATTTTTAGCAGGG - Intergenic
980658319 4:135819812-135819834 ATTCAGAAACAGTTCTAACACGG + Intergenic
980720268 4:136686619-136686641 AGGCAGAGACAGCTTGTGCAGGG + Intergenic
980727755 4:136787166-136787188 AGGGAGGAACAGTTTTTGGAGGG + Intergenic
980852495 4:138399829-138399851 AGTCAGAAAAAGTATTAGAAGGG + Intergenic
981068167 4:140507245-140507267 AGGGAGAAACAGATTTAAAAAGG - Intergenic
981176288 4:141687576-141687598 AGTCAGAAGCAGCTTTACCATGG - Intronic
981437341 4:144740933-144740955 TGGCAGAAACAGTAGTAGAAAGG - Exonic
981706554 4:147665281-147665303 AGGCAGAATTAGTTTTTGGAAGG - Intronic
983076948 4:163337904-163337926 GGGCAGAAACAGTTTCAGGTGGG - Intronic
983580799 4:169308036-169308058 AGGCAGAAATAGTTTTGGTCTGG - Intergenic
983687104 4:170423335-170423357 GGACAGAAACATTTTTAGGAGGG + Intergenic
984082653 4:175267673-175267695 AGGAAAAAAAAGTTTTAGTAAGG - Intergenic
984927928 4:184822926-184822948 AGGCAGGGGCAGTTTTACCAGGG - Intronic
985469912 5:33866-33888 AGTCAGAATCAGTCTTAGCATGG - Intergenic
986314975 5:6581088-6581110 AGGCAGAAATAATTTGAGAAAGG + Intergenic
987544221 5:19291394-19291416 AGCCTGAAACATTTTTAGCATGG - Intergenic
989234700 5:39133233-39133255 ATGCAGACACAGTTTTACCCAGG + Intronic
989692592 5:44162393-44162415 AGGCAGAGACACTCTTAGCTGGG - Intergenic
993526283 5:88969724-88969746 ATGCAGTCACAGTTTTGGCAAGG + Intergenic
994857001 5:105135419-105135441 AAGCAGAAACAATGTTAGCTTGG + Intergenic
995645814 5:114310025-114310047 AGGCACAAAAAGTTTTAAGAAGG - Intergenic
996154397 5:120080071-120080093 AGGCAGAGAGAGATTGAGCATGG + Intergenic
996947174 5:129084437-129084459 AGGCAGTCATAGTTTTAGCCTGG - Intergenic
996993646 5:129667866-129667888 AGGAAGAAGAGGTTTTAGCATGG - Intronic
997637686 5:135426475-135426497 AATCAGAAACAGTTTTAACAAGG - Intergenic
998879123 5:146629254-146629276 GGGAAGGAACAGTTTTGGCATGG - Intronic
999068018 5:148712861-148712883 AGGCAGACCCAGAGTTAGCAGGG + Intergenic
999333675 5:150696446-150696468 AAGCAGAAACAGTTTAAGTTAGG + Intronic
1001866759 5:175112994-175113016 AGGAAGAAACAGTGTTGGGAAGG + Intergenic
1005706220 6:28456252-28456274 AGGAAAAAATAGTTTTAGTAGGG + Intergenic
1007270656 6:40634578-40634600 AGGCAGAGACTGGCTTAGCAGGG + Intergenic
1007643779 6:43364860-43364882 AGGCTGAAACAGATTCAGAAAGG - Intronic
1008652598 6:53578144-53578166 AGGCAGAAACAGAGTTAGCCGGG - Intronic
1010669719 6:78673938-78673960 AGGCAGGAAGCGTTCTAGCAGGG - Intergenic
1011270783 6:85577913-85577935 AGGCAAAAACAATTTTAGAATGG + Intronic
1013299426 6:108789952-108789974 AGGCAGATAGCGTTTTGGCAAGG - Intergenic
1015916134 6:138219141-138219163 AGGAAGAAGCATGTTTAGCAGGG + Intronic
1016159178 6:140855919-140855941 AGATAGCAACAGGTTTAGCAGGG - Intergenic
1016704340 6:147089264-147089286 AGGGAGAAAGACATTTAGCATGG + Intergenic
1016828280 6:148408024-148408046 AGGAAAAAAAAGTGTTAGCAAGG - Intronic
1017967523 6:159279446-159279468 AGGCAGAAACCATTTGATCAAGG + Intergenic
1020405599 7:7830177-7830199 AGGTAGACACAGTCCTAGCAGGG - Intronic
1020917022 7:14207378-14207400 AGGCAGAAACAGTTCTGGCCAGG + Intronic
1022632165 7:32095458-32095480 AGGGTGAACCAGTTTTAGCAAGG - Intronic
1024922474 7:54574279-54574301 AGTCACAATCACTTTTAGCAGGG - Intergenic
1026544413 7:71309345-71309367 AGGAAGAAGCAAATTTAGCAGGG - Intronic
1027714037 7:81646345-81646367 AGTCAGAACCAGTTTCAACAGGG + Intergenic
1027748201 7:82105906-82105928 AGACTGAAACAATATTAGCATGG + Intronic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1028649716 7:93138022-93138044 AACCAGGAACAGTTTTACCAAGG - Intronic
1030728807 7:112959405-112959427 AGGCAAAAAGAATTTTAACAAGG + Intergenic
1031550397 7:123104651-123104673 CTGAAGAAAGAGTTTTAGCAAGG + Intergenic
1032259409 7:130322847-130322869 TGGCAGAACCAGTTCTTGCAGGG - Exonic
1033415135 7:141155332-141155354 AGGGAAAAACAGAATTAGCAAGG - Intronic
1033570433 7:142623082-142623104 AGGCAGCTAAAGTTTTGGCATGG + Intergenic
1035091250 7:156313440-156313462 AAGCAGAAACAGTTTGAAAAGGG - Intergenic
1035595793 8:856506-856528 ACTAATAAACAGTTTTAGCAGGG + Intergenic
1038848874 8:31255040-31255062 AGGAAGACACAGTTTGAGAAAGG - Intergenic
1039482316 8:37883506-37883528 ATTCAAAAACAGTTTAAGCAAGG + Intronic
1039744946 8:40416405-40416427 AAGTAGAAATAGTTTAAGCAAGG - Intergenic
1040453399 8:47571694-47571716 AGGCAAAAACAGTTTATACAAGG - Intronic
1043022394 8:75020110-75020132 AGGCAAAAACAGTTATCACAGGG - Intronic
1045005393 8:97912905-97912927 AGGAAGAAAAAGATTTAACACGG + Intronic
1045287427 8:100804102-100804124 AGGAGAAAACAGTTTCAGCAAGG + Intergenic
1045757471 8:105561865-105561887 AGGTACAAACAGTATTACCAAGG - Intronic
1047565722 8:126041426-126041448 AGGCAGAGAGAGCTTGAGCAGGG - Intergenic
1051049626 9:12915732-12915754 AGACAGAAACAGAGTTTGCAAGG - Intergenic
1052335169 9:27311970-27311992 GGTCAGAAACATTTGTAGCAGGG + Intergenic
1053319597 9:37084130-37084152 AGGAATAAACAGGTTTATCAGGG + Intergenic
1053406270 9:37878913-37878935 TGGCTGAAACAGTCTTATCAAGG + Intronic
1056147800 9:83751531-83751553 AGTCAAAAAAAGTTTTAGTAGGG + Intronic
1058038834 9:100282476-100282498 AGGAAGAAAGAGTTTCAGAAGGG + Intronic
1059050573 9:110920185-110920207 AGGCAGCAACAGCTCTAGCATGG + Intronic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1059843584 9:118245958-118245980 AGGCAAAAATAGTTTGTGCAGGG - Intergenic
1060213278 9:121723434-121723456 AGGTAGAGACAGTTTCATCAGGG - Intronic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1060963641 9:127699336-127699358 AGGCCGAAACACTGTGAGCAAGG + Intronic
1061597266 9:131639897-131639919 AGGAGGAAACAATTTTTGCAAGG + Intronic
1062378816 9:136277001-136277023 AGGCAGAGCCAGCCTTAGCAGGG - Intergenic
1185940073 X:4308019-4308041 AGGCAGAAAGTGCTCTAGCAGGG + Intergenic
1187567994 X:20471631-20471653 GGTCAGAAACTGTTTTACCAGGG - Intergenic
1188642651 X:32525215-32525237 GGACAAAAAGAGTTTTAGCAAGG - Intronic
1190408151 X:50108283-50108305 AAGCAGAAACACTGTTAGCTTGG - Intergenic
1190878926 X:54479100-54479122 AACCAGAAACAATTTTTGCAAGG - Intronic
1191127842 X:56976280-56976302 AGTCAGATACAGTTTTTGTAAGG - Intergenic
1193542322 X:82787633-82787655 AGGCAGAAAGAGCTTTTGCAGGG - Intergenic
1196023016 X:111010099-111010121 AGGAAGAAACAGTTTCAGATGGG - Intronic
1197061153 X:122183458-122183480 AGGAAGAAAAAGTGCTAGCAGGG - Intergenic
1199027727 X:142960067-142960089 AGGTAGAAACAGTTCTTGCCAGG + Intergenic
1199085069 X:143618518-143618540 AAACAGAAACAGTTTTAGTGAGG + Intergenic
1202083592 Y:21111196-21111218 AGGCAGAAAAAGTCAAAGCAGGG + Intergenic