ID: 1097703542

View in Genome Browser
Species Human (GRCh38)
Location 12:62845080-62845102
Sequence CCGACCAAGAAGGCCCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097703536_1097703542 -5 Left 1097703536 12:62845062-62845084 CCCTATTAACAGTTAGAGCCGAC 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1097703542 12:62845080-62845102 CCGACCAAGAAGGCCCTGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 124
1097703533_1097703542 30 Left 1097703533 12:62845027-62845049 CCACCTCTGGCTTCTGCCTTATA 0: 1
1: 0
2: 2
3: 39
4: 889
Right 1097703542 12:62845080-62845102 CCGACCAAGAAGGCCCTGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 124
1097703534_1097703542 27 Left 1097703534 12:62845030-62845052 CCTCTGGCTTCTGCCTTATAAAT 0: 1
1: 1
2: 2
3: 38
4: 362
Right 1097703542 12:62845080-62845102 CCGACCAAGAAGGCCCTGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 124
1097703535_1097703542 14 Left 1097703535 12:62845043-62845065 CCTTATAAATAAGTTCTCACCCT 0: 1
1: 0
2: 0
3: 10
4: 182
Right 1097703542 12:62845080-62845102 CCGACCAAGAAGGCCCTGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 124
1097703537_1097703542 -6 Left 1097703537 12:62845063-62845085 CCTATTAACAGTTAGAGCCGACC 0: 1
1: 0
2: 0
3: 4
4: 24
Right 1097703542 12:62845080-62845102 CCGACCAAGAAGGCCCTGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097703542 Original CRISPR CCGACCAAGAAGGCCCTGGA GGG Intronic
900192195 1:1356367-1356389 CAGACCCCGAAGGCCCTGGTTGG + Intronic
902828631 1:18995358-18995380 GAGACCAACAGGGCCCTGGAGGG + Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
908414424 1:63899012-63899034 CCCACCAAGAAGCACCGGGACGG + Intronic
918316178 1:183324496-183324518 TTGACCCAGAAGGCCCTGCATGG + Intronic
922506212 1:226127314-226127336 GCGGCCAAGAAGACGCTGGAGGG + Intergenic
1065371070 10:24987072-24987094 CAGCCACAGAAGGCCCTGGAGGG + Intronic
1065481067 10:26194309-26194331 CCCACGAAGAAGGCCTTGGAAGG - Intronic
1072415126 10:95240965-95240987 CTGAGCCAGAAGGCCCAGGATGG + Intronic
1074777805 10:116779130-116779152 CTGCCGATGAAGGCCCTGGAGGG - Intergenic
1075519711 10:123136264-123136286 GCGGCCAAGGGGGCCCTGGAGGG + Exonic
1077028561 11:452604-452626 CCCACCCAGAAGACCCAGGAAGG - Intronic
1077252120 11:1565342-1565364 CTGAGCAAGGAGGCCCTGGAGGG + Intronic
1079241390 11:18724530-18724552 CCAACCAAGTAAGGCCTGGAGGG + Intronic
1083962566 11:66022516-66022538 GAGCCCGAGAAGGCCCTGGAGGG - Intronic
1087046796 11:93849966-93849988 ATGACCAGGAAGGCCATGGAGGG + Intronic
1092564304 12:9648354-9648376 CCAACCGAGAAGGCCCTGGCGGG - Intergenic
1097703542 12:62845080-62845102 CCGACCAAGAAGGCCCTGGAGGG + Intronic
1101940949 12:109098438-109098460 CCAGCCAAGAAGGCCCCGGCTGG + Exonic
1103936833 12:124481476-124481498 CCTGCCATGCAGGCCCTGGAGGG + Intronic
1104965168 12:132505670-132505692 ACGACCAAGGAGGCCCAGGCAGG - Intronic
1105413458 13:20190949-20190971 CTGACCAAGGTGGCACTGGATGG - Intronic
1106226184 13:27789003-27789025 CCCACCCAGGAAGCCCTGGAGGG - Intergenic
1113204206 13:107896874-107896896 GAGACCAAGAAGCCACTGGAAGG - Intergenic
1116660977 14:47709906-47709928 CCCACAAAGATGACCCTGGAGGG + Intergenic
1121328856 14:93037057-93037079 TGGACCAGGGAGGCCCTGGAAGG + Intronic
1122307978 14:100777434-100777456 CCCAGCAAGCAGGGCCTGGAAGG + Intergenic
1122773612 14:104107737-104107759 CCCACCAAGCAAGCCCTGGCTGG + Intronic
1124215511 15:27805042-27805064 GCCACCAAGAAGCCCCTGCAAGG + Intronic
1128734403 15:70044630-70044652 CAGAGCAAGAGGGTCCTGGAAGG - Intergenic
1128783792 15:70380043-70380065 CCCAACAAGGAGGCCCAGGATGG - Intergenic
1131655010 15:94447132-94447154 CCCACTAAGAAGGCCCTGTCTGG - Intronic
1132502081 16:288930-288952 CCGAAGATGAGGGCCCTGGACGG + Intronic
1132539718 16:503090-503112 CTGACAAGGTAGGCCCTGGAGGG + Exonic
1139829142 16:69782392-69782414 CCAACCAAGAAGGCTCAGGTGGG + Intronic
1144279170 17:13707268-13707290 CCGACGAATAAGGCCCTGAATGG - Intergenic
1144685210 17:17221581-17221603 CTGACCGAGAAGCTCCTGGAAGG - Exonic
1146223503 17:31047077-31047099 GAGATAAAGAAGGCCCTGGAAGG + Intergenic
1146652125 17:34613451-34613473 CCAACCGAGAAGGCCCAGGAGGG - Intronic
1147388700 17:40096573-40096595 CCGACGGAAAAAGCCCTGGAGGG + Exonic
1147498064 17:40936667-40936689 CCGCCCCAGACTGCCCTGGATGG + Exonic
1148686629 17:49504707-49504729 CCCAGGAAGAAGGGCCTGGAGGG - Intronic
1152596643 17:81240984-81241006 CAGGCCAAGAAGACGCTGGAGGG + Exonic
1152932585 17:83117533-83117555 CCGACCAGGAAGCCCCCAGAAGG - Intergenic
1157000653 18:43519498-43519520 CCAACTATTAAGGCCCTGGAGGG + Intergenic
1159831515 18:73283787-73283809 CCAACCAAGAAGGCACTGAGCGG + Intergenic
1162958857 19:14114484-14114506 CCCCCCAAGAAGACCCTAGATGG - Intronic
1163239757 19:16053590-16053612 CCCACAAAAAAAGCCCTGGAGGG - Intergenic
1165067126 19:33235883-33235905 CCGGCCAAGATGGGCCTGGCAGG - Intergenic
1166343613 19:42152363-42152385 CCTGCCAAGAAGGCCCCAGATGG + Intronic
1167768039 19:51497260-51497282 CAGACCTGGAAGGACCTGGATGG - Intronic
1168250880 19:55141323-55141345 CCGTCCTAGGAGACCCTGGAGGG + Intronic
925489755 2:4377942-4377964 TAGAACAAGAAGGCCATGGATGG - Intergenic
926134256 2:10325587-10325609 CCTGCTAAGCAGGCCCTGGAGGG + Intronic
927211306 2:20640702-20640724 CTGGCCAGGAAGGCCATGGATGG + Intronic
933505896 2:83177048-83177070 CCGACCAAGAACCCACCGGAAGG - Intergenic
933912928 2:86960038-86960060 CCCACCAGGAAGCCCCAGGAGGG + Intronic
934010067 2:87809852-87809874 CCCACCAGGAAGCCCCAGGAGGG - Intronic
935171612 2:100614733-100614755 CCCAGCAGGGAGGCCCTGGAGGG + Intergenic
935773637 2:106450560-106450582 CCCACCAGGAAGCCCCAGGAGGG - Intronic
935906427 2:107845380-107845402 CCCACCAGGAAGCCCCAGGAGGG + Intronic
936128211 2:109810489-109810511 CCCACCAGGAAGCCCCAGGAGGG + Intronic
936216486 2:110560996-110561018 CCCACCAGGAAGCCCCAGGAGGG - Intronic
936425627 2:112415567-112415589 CCCACCAGGAAGCCCCAGGAGGG - Intronic
937050419 2:118883761-118883783 CAGACCAAGAACTCACTGGAAGG - Intergenic
941771012 2:169345919-169345941 TAGAACAGGAAGGCCCTGGAGGG + Intronic
942101974 2:172592599-172592621 CAGACCAAGAACCCACTGGAAGG + Intronic
947437431 2:230084632-230084654 CCCAGCAAGTAGACCCTGGAAGG - Intergenic
947591445 2:231388418-231388440 CCGTCCAAGCTGGCCCTGAATGG - Intergenic
1169087522 20:2836543-2836565 CAAACAAAGAAGGCTCTGGAGGG - Intronic
1172447238 20:34999633-34999655 AAAACCAAGAAGGCGCTGGAAGG + Exonic
1174284153 20:49460424-49460446 CTGGCCACCAAGGCCCTGGAAGG - Intronic
1175191406 20:57214489-57214511 CCAACCTGTAAGGCCCTGGATGG + Intronic
1178725894 21:35051446-35051468 CCGCCCAGGAAGGCCGTGCAGGG - Intronic
1180005692 21:45019386-45019408 CCGACCTGGGGGGCCCTGGAGGG + Intergenic
1181005019 22:20009197-20009219 CCAACCCAGAAGACCCTGCATGG + Intronic
1181022196 22:20109455-20109477 CCCACCCAGAAGGCCCAGGTGGG - Intronic
1181516105 22:23414745-23414767 CAGCCCAAGGAGGTCCTGGAGGG + Intergenic
1182038924 22:27221005-27221027 CAGACCAAGTGGGCTCTGGAGGG - Intergenic
1183259627 22:36786038-36786060 CTCACCAGGAAGCCCCTGGAGGG - Intergenic
1185071626 22:48659727-48659749 CCCACCAAAAAGGCCAGGGACGG - Intronic
949937832 3:9130626-9130648 CAGACCAAGAAGTTCCTGTAGGG - Intronic
950022003 3:9793636-9793658 CTGACCAGGAAGGGCCTGAATGG - Intronic
951522314 3:23621232-23621254 CCGCCCAAGGAGGCCCCTGAGGG + Intergenic
951641720 3:24844111-24844133 CAGCCCTAGAAGGGCCTGGAGGG + Intergenic
952492050 3:33882372-33882394 CCCACAAAGGACGCCCTGGATGG - Intergenic
961869437 3:129977049-129977071 CCGGGCAAGAGGGCCCTGGGAGG + Exonic
961935256 3:130576011-130576033 CCATCTAAGAAGCCCCTGGAGGG - Intronic
964111566 3:153093137-153093159 CTGACCCCGAAGGCCTTGGATGG + Intergenic
964184240 3:153923559-153923581 ACGACCAAGAACCCACTGGAAGG - Intergenic
967824642 3:193868748-193868770 CCCACCCAGAGGGCACTGGAGGG + Intergenic
972912886 4:43840403-43840425 CAGAGCAAGAAGGCTCTGAAGGG - Intergenic
973820275 4:54657281-54657303 CCGCCCAAGAAGCCCCTGCCGGG - Intergenic
985639320 5:1056224-1056246 CTGACCCAGAAGGACGTGGATGG + Intronic
989590947 5:43112380-43112402 CAGACCAAGAACCCACTGGAAGG - Intronic
997237165 5:132279431-132279453 CAGACCAAGAACACCCTGGATGG - Intronic
997640392 5:135445110-135445132 CCTGCCAAGGAGACCCTGGAGGG - Exonic
998269876 5:140696990-140697012 CAGAACAAGCAGGCCCTGGAGGG + Exonic
998544002 5:143010504-143010526 CCAACAAAGAAGGCCCAGGGTGG - Intronic
1002314268 5:178333281-178333303 CAGGCCAAAAAAGCCCTGGAAGG + Intronic
1006467748 6:34206227-34206249 CCCACCAGGAAGCCCCAGGAGGG + Intergenic
1006910043 6:37557784-37557806 CAGAACATGAAGTCCCTGGAGGG + Intergenic
1008167358 6:48154847-48154869 CCAACCAAAAATGCCCTGAATGG + Intergenic
1013977816 6:116096916-116096938 GAGACCAAGAACCCCCTGGAAGG + Intergenic
1017398615 6:154032766-154032788 CCTACCTAGAAGGCCAAGGAAGG + Intronic
1017681804 6:156871826-156871848 CAGTCCCAGGAGGCCCTGGAAGG - Intronic
1021356904 7:19660667-19660689 GAGACCAAGAAGTCACTGGAAGG - Intergenic
1024485058 7:49908595-49908617 CCCACCAAGAAGGCCTAGAAGGG + Intronic
1029946402 7:104537886-104537908 CTGCCCAAGAAGGACCTTGATGG - Intronic
1030656094 7:112169639-112169661 TGGAACAAGAAGGCCTTGGATGG - Intronic
1034569056 7:151940714-151940736 CAGAGCAAGAGGGCCCGGGAGGG + Intergenic
1037262854 8:17027380-17027402 CCGGCCAGGAAGGCCCAGGGTGG - Exonic
1038216337 8:25564918-25564940 CCGGCCAAGAAGAGACTGGAAGG + Intergenic
1051197655 9:14580680-14580702 CCCACAAAGAAAGCCCAGGACGG + Intergenic
1052056823 9:23916298-23916320 CAGACCAAGAACCCACTGGAAGG - Intergenic
1055972758 9:81928315-81928337 GCGACCTAGAGGGCCCAGGAAGG + Intergenic
1055974511 9:81943387-81943409 GCGACCTAGAGGGCCCAGGAAGG + Intergenic
1057249103 9:93485277-93485299 CTGACCAAGAATGTCTTGGAAGG - Intronic
1061315101 9:129790491-129790513 CACACCAAGAAGGCACTAGAGGG - Intergenic
1061671409 9:132190520-132190542 CTGACTAAGGAGGCCGTGGAGGG - Intronic
1062191370 9:135249558-135249580 CAGCCCAGGAAGGCCCAGGAAGG + Intergenic
1062268725 9:135699298-135699320 CCGCCCCAGGAGGCCCAGGATGG + Intronic
1062731491 9:138112653-138112675 CCAACCAAGAGAGCCCTGGGTGG + Intronic
1185713525 X:2323181-2323203 CCAACCAACAAGCACCTGGAAGG + Intronic
1191794311 X:65004103-65004125 CCAACCAAAAAAGCCCAGGATGG + Intronic
1198763084 X:140053989-140054011 CCTCCCAAGAAGCCCCTGCACGG - Intergenic
1200182958 X:154162360-154162382 CCGCCCCAGGAGGCCCAGGAGGG + Intergenic
1200188612 X:154199474-154199496 CCGCCCCAGGAGGCCCAGGAGGG + Intergenic
1200194261 X:154236615-154236637 CCGCCCCAGGAGGCCCAGGAGGG + Intergenic
1200200017 X:154274418-154274440 CCGCCCCAGGAGGCCCAGGAGGG + Intronic
1200224397 X:154409242-154409264 CCGGCCAGGAAGGGCCTGGCTGG + Intronic
1201364266 Y:13186360-13186382 CCCACCAAGACGGCACAGGAGGG - Intergenic