ID: 1097711536

View in Genome Browser
Species Human (GRCh38)
Location 12:62922890-62922912
Sequence TCACTCCTCTTTTCAGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097711536_1097711538 -10 Left 1097711536 12:62922890-62922912 CCACCAGCTGAAAAGAGGAGTGA 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1097711538 12:62922903-62922925 AGAGGAGTGATTCAAGTTTTAGG 0: 1
1: 0
2: 0
3: 19
4: 299
1097711536_1097711539 15 Left 1097711536 12:62922890-62922912 CCACCAGCTGAAAAGAGGAGTGA 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1097711539 12:62922928-62922950 GATTTCCTAATTTAATTAAATGG 0: 1
1: 0
2: 1
3: 28
4: 456
1097711536_1097711540 16 Left 1097711536 12:62922890-62922912 CCACCAGCTGAAAAGAGGAGTGA 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1097711540 12:62922929-62922951 ATTTCCTAATTTAATTAAATGGG 0: 1
1: 1
2: 4
3: 57
4: 716

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097711536 Original CRISPR TCACTCCTCTTTTCAGCTGG TGG (reversed) Intronic
902708910 1:18225551-18225573 TCCCTCCTCTTTCCAGTGGGAGG + Intronic
905546095 1:38801595-38801617 TAGCTCCTCTCTGCAGCTGGTGG - Intergenic
906072861 1:43029804-43029826 TCAGTCCTTTTTTTAACTGGTGG + Intergenic
907320627 1:53600012-53600034 CACCTCCTCTTTTTAGCTGGGGG - Intronic
910047747 1:82938377-82938399 TGACTCTTATTTTCAGCTGTTGG + Intergenic
910649044 1:89544717-89544739 TCTATCCTCTTTTCTACTGGAGG + Intronic
913320849 1:117587425-117587447 TCACTCCTCGTGTCTGCTGCTGG + Intergenic
914918676 1:151833311-151833333 TGGCTCCTCCTGTCAGCTGGAGG - Intergenic
916442877 1:164844924-164844946 TCACTCCTTTTCTCTGTTGGAGG - Intronic
917063954 1:171071346-171071368 ACACTCCTTTTTTAAGCTGTTGG + Intergenic
919818805 1:201459763-201459785 TCTTTCTTCTTTGCAGCTGGGGG + Intergenic
921813827 1:219544667-219544689 TCATCCCTCTTTTCATCTGCAGG - Intergenic
921979584 1:221241300-221241322 TCACTGCTGATTTCAGTTGGTGG - Intergenic
923262533 1:232281289-232281311 TCTGTCCTCTTTTCTGCAGGAGG - Intergenic
923292056 1:232555392-232555414 TGACTCCTCACTCCAGCTGGAGG - Intronic
924608231 1:245553180-245553202 CCACTCCTCTTTTACACTGGAGG + Intronic
1065880492 10:30033671-30033693 ACAGTCTGCTTTTCAGCTGGTGG + Intronic
1067265678 10:44742192-44742214 TCCCTCCTCTTCCCAGCTGTTGG - Intergenic
1067655364 10:48187717-48187739 TTGCTCCTGTTTTCAGCTGGAGG + Intronic
1072338933 10:94427332-94427354 TCCTTCCTCTTTTCTTCTGGTGG + Intronic
1072863408 10:99030973-99030995 TCACTACTCTTTTCAGCCTCTGG - Intronic
1075525849 10:123186087-123186109 TCACTGGTCTTGGCAGCTGGTGG + Intergenic
1077089844 11:773437-773459 TCCCACCTCTCTTCTGCTGGTGG + Intronic
1078205803 11:9228357-9228379 TCTCTCCTCTCTGCAGGTGGTGG - Intronic
1078396773 11:10988467-10988489 TCTCTCCTCTTTTCAACTTAGGG - Intergenic
1079733271 11:23962353-23962375 TAGCTCCTCTCTGCAGCTGGTGG - Intergenic
1083330784 11:61897496-61897518 CCACGCCTGTTTTCAGCTGTGGG - Exonic
1084694964 11:70747366-70747388 ACAGTCCTGTTTTCTGCTGGTGG + Intronic
1085507705 11:77069611-77069633 ACCCTGCTCTTTGCAGCTGGGGG - Intronic
1085625382 11:78067866-78067888 TCGCTCCTCTTAACAGCTTGGGG + Exonic
1085918214 11:80918010-80918032 TCACTGCTGTGTTCAGCTGGTGG + Intergenic
1087219508 11:95531177-95531199 TCAGTCCTCTTTCCCCCTGGTGG - Intergenic
1088226028 11:107621250-107621272 CCTTTCCTCTTTTCTGCTGGAGG - Intronic
1088475727 11:110236921-110236943 TCATTCCTCTTTTCAAAGGGAGG + Intronic
1089654538 11:119937216-119937238 TCACTCATCTTTTCATCTATTGG - Intergenic
1089822504 11:121241309-121241331 TAGCTCCTCTCTGCAGCTGGTGG + Intergenic
1091852934 12:3714982-3715004 TTACTTCTCTTTACAGCTGAGGG + Intronic
1094300363 12:28957908-28957930 TCACTATTCTTTTCTTCTGGTGG - Intergenic
1097711536 12:62922890-62922912 TCACTCCTCTTTTCAGCTGGTGG - Intronic
1098814624 12:75142898-75142920 ACACTCCTCTCTTCAACAGGTGG - Intronic
1101828940 12:108242272-108242294 TCACTCCTCTTCTCAGTGAGGGG + Intronic
1103209955 12:119158488-119158510 TCACTCCTGTCTTCTGATGGAGG - Exonic
1103230863 12:119329214-119329236 TGACTCCTCTTCTCACCTGCTGG - Intergenic
1103231038 12:119330618-119330640 TGACTCCTCTTCTCACCTGCTGG - Intergenic
1107972564 13:45657785-45657807 TGACTGCTATTTTAAGCTGGAGG + Intergenic
1109034883 13:57243786-57243808 TCACTCATCTTTTCAGTGGAAGG + Intergenic
1112427103 13:99312637-99312659 TGACTCCTCCTGGCAGCTGGTGG - Intronic
1114690285 14:24574484-24574506 TGACTCTTCTGCTCAGCTGGAGG + Exonic
1114734233 14:25026904-25026926 TCACTGCTTTTCTCACCTGGTGG - Intronic
1115662178 14:35507430-35507452 TCACTCCTCTGTGAAGCTTGAGG + Intergenic
1116336082 14:43658373-43658395 TTAATTTTCTTTTCAGCTGGTGG - Intergenic
1116921943 14:50587812-50587834 TCACTGCTCTGTTCAACAGGTGG + Exonic
1117719461 14:58614910-58614932 TGACTCCTGATTTCAGGTGGTGG - Intergenic
1120565850 14:86055784-86055806 TCTCACCTCTTTTCAACTTGAGG - Intergenic
1121042270 14:90758831-90758853 TCACTCCCCTTCTCAAATGGGGG + Intronic
1124937618 15:34187127-34187149 GTACTCCTCTCTGCAGCTGGTGG - Intronic
1125199608 15:37091101-37091123 TCACACCACTTTTCAGGTAGTGG + Intronic
1128370780 15:67037466-67037488 TCAGTCCTCTTTGTAGCTGCTGG - Intergenic
1128726891 15:69994608-69994630 TCTTTCCTCTTTTCTGCTGCTGG + Intergenic
1130968733 15:88716596-88716618 TCATTCCTCTCTTCAGAGGGTGG + Intergenic
1133287638 16:4697964-4697986 CCACTGCTCTTACCAGCTGGGGG + Exonic
1134857020 16:17528381-17528403 TCACTCCTCCTTTCCTCTGTAGG + Intergenic
1139483829 16:67245436-67245458 ACACACCTCTTCCCAGCTGGGGG - Intronic
1139793021 16:69455779-69455801 TTACTCCTCTATGTAGCTGGTGG + Intronic
1141101143 16:81198424-81198446 TCATTCCTCGTTACAGTTGGGGG - Intergenic
1146972402 17:37083505-37083527 TCACTCCTCTTTTCAACAAAAGG - Intergenic
1148201061 17:45750304-45750326 TCAATCCTGTTTCCAGATGGAGG + Intergenic
1149451158 17:56751159-56751181 TCACTGCTCATCTCTGCTGGTGG + Intergenic
1149630387 17:58116977-58116999 ACACTCTTCTTTTCATGTGGTGG + Intergenic
1150207588 17:63420618-63420640 ACACTCATACTTTCAGCTGGAGG - Exonic
1150243370 17:63654228-63654250 TCTCTCCTCTTCTCAGCTCTTGG + Intronic
1151164375 17:72191508-72191530 TTTCTCCTCCTTTCAGTTGGTGG + Intergenic
1151773116 17:76177748-76177770 TTGCTCCTCTCTGCAGCTGGTGG - Intronic
1152022195 17:77785925-77785947 ACACTCCTCTCATCAGCTGAAGG + Intergenic
1152672237 17:81615777-81615799 TGGTTCCTATTTTCAGCTGGTGG - Intronic
1153768494 18:8397058-8397080 ACACTGCTCTTTTCAGCTGCTGG - Intronic
1153926414 18:9838942-9838964 CCACTCCTCCTTTCTGCTGAAGG + Intronic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1156321679 18:36031245-36031267 TCACTTCACTTTTGAGCTGCTGG - Intronic
1157721020 18:49924543-49924565 TCCCTCCTCTTTCCAGCTTGTGG - Intronic
1158108947 18:53918611-53918633 TCTCTCCTCTTGTCAGAAGGAGG + Intergenic
1160543858 18:79640167-79640189 TTGTTCCTGTTTTCAGCTGGAGG + Intergenic
1166319646 19:42008917-42008939 TCCCTCATCTTTTCTGCTGCCGG - Intronic
1167500092 19:49841284-49841306 TAATTCCTCTTTGGAGCTGGTGG - Intergenic
928575228 2:32648060-32648082 TCACTGATTTTTTCCGCTGGAGG + Intronic
930024485 2:47021846-47021868 TCTCTCCTCTTTGCAGCTAGAGG + Exonic
930581835 2:53220875-53220897 TTCCTCCTCTCTGCAGCTGGGGG + Intergenic
930591897 2:53337563-53337585 TTACTCCTCTTTTCATCTAAAGG + Intergenic
933726857 2:85431892-85431914 TCACTGCTCCCTTCAGCTGTGGG - Intronic
935694587 2:105760508-105760530 TCACACCTCTTCCCTGCTGGTGG + Intronic
936261287 2:110961528-110961550 GCTCTCCTCTTTTCCGGTGGAGG - Intronic
936936944 2:117847915-117847937 TCACTCCCCTTCTCGGCTGCTGG - Intergenic
938761441 2:134430079-134430101 CAACTCCTCTTTGCAGCTGCAGG - Intronic
939467827 2:142581116-142581138 TGACTCCTCTTTTCATCTACTGG - Intergenic
942814407 2:180034586-180034608 CCACTTCTCTTTTCATGTGGGGG + Intergenic
943200434 2:184816791-184816813 TCACTCCTCTACTCAGATGAGGG + Intronic
943810252 2:192177662-192177684 TCACTCTTCCTTTCAGTTAGAGG - Intronic
944880627 2:204009383-204009405 TCACTCCCTTATTCAGCAGGAGG - Intergenic
945136929 2:206639460-206639482 TCATTTCTCCTTTCAGCTGATGG + Intergenic
945414146 2:209549912-209549934 TTACTCGTCTTTACAGTTGGTGG + Intronic
946157201 2:217814804-217814826 TCAGTCCTCTTTGTAGCAGGGGG - Intronic
948218503 2:236250544-236250566 TCACCCCTTTTTTTACCTGGAGG + Intronic
948660029 2:239501376-239501398 CCCTTCCTCTATTCAGCTGGTGG + Intergenic
1169497383 20:6128443-6128465 TTACCTCTCTTGTCAGCTGGAGG - Intergenic
1177055381 21:16295115-16295137 GCACTAATATTTTCAGCTGGAGG + Intergenic
1177874050 21:26609697-26609719 TCACTCCTCTTTCCATCTGAGGG + Intergenic
1178047404 21:28710963-28710985 TAACCCGTCTTTTCTGCTGGTGG + Intergenic
1178431198 21:32520206-32520228 CCACTCCTCTCAGCAGCTGGAGG - Intergenic
1181173579 22:21023577-21023599 TCACTACTCCTTCCAGCTGCAGG + Exonic
1182711110 22:32323874-32323896 TCACTCCTTTTTGCTGCTGCAGG + Intergenic
1183076429 22:35430281-35430303 TCAATCCTCTTAACATCTGGGGG - Intergenic
1184398637 22:44260747-44260769 TCACTCCTTTTTGCTGCTGCAGG + Intronic
951779389 3:26346169-26346191 TTCCTCCTCTTTTCAGCTTTAGG + Intergenic
952424318 3:33159302-33159324 TCACACTTCTTTTTAGCTGTTGG - Intronic
952771863 3:37008798-37008820 TCAATCTTCTGTTCAGGTGGAGG + Exonic
953343972 3:42159971-42159993 CCACTCCTCATTGCTGCTGGGGG + Intronic
953683886 3:45061046-45061068 GGACTCCTCTTTCCAGATGGAGG + Intergenic
956890759 3:73611930-73611952 TTACACCTCTTTTCAATTGGTGG - Intronic
962143994 3:132820942-132820964 TCACTTCTCTTCTCAGCTCAGGG + Intergenic
962736209 3:138327765-138327787 GCTCTCCTCCTTTCAGCAGGAGG + Intronic
963339473 3:144017469-144017491 TCACTCCACTTTTCAGTTGGTGG + Intronic
963759143 3:149268722-149268744 TCTCAGCTCTTTTGAGCTGGAGG + Intergenic
964774450 3:160260030-160260052 TCATGCCTCTTTTATGCTGGAGG + Intronic
967459908 3:189733829-189733851 TCACTTCTCTTTTGAGATTGTGG - Intronic
968091407 3:195900522-195900544 ACACTCCGGTCTTCAGCTGGCGG - Intronic
971156235 4:24086222-24086244 TCAGATCTCTTTTCAGATGGAGG + Intergenic
971508164 4:27389360-27389382 TTACTGGTCTTTTCAACTGGAGG + Intergenic
977254432 4:94725398-94725420 TCACTCCTTTTTCCACCTGCAGG + Intergenic
977672878 4:99716185-99716207 TTTCTCCTCTCTTCTGCTGGTGG - Intergenic
978969226 4:114782591-114782613 TCACTCCTCTCTTTCCCTGGAGG + Intergenic
983388862 4:167102949-167102971 TCACTCCTTCTTTCTGCTTGAGG + Intronic
983651498 4:170040732-170040754 TAGCTCCTCTCTGCAGCTGGTGG - Intergenic
987980259 5:25075023-25075045 TCACTACCCTTTTCAGCTTCTGG + Intergenic
988627320 5:32891460-32891482 TCCTGCCTCTTTTCAGATGGAGG + Intergenic
989155145 5:38337843-38337865 TCCTTCCTCTGTTCAGCTGTGGG + Intronic
989298114 5:39853648-39853670 TATCTCCTCTTTACAGCCGGTGG - Intergenic
990502088 5:56407117-56407139 TCACTCCTCTCTTTGGTTGGAGG + Intergenic
993498452 5:88635304-88635326 TCACTCCTCATATCATCTGTAGG - Intergenic
995523377 5:113031484-113031506 TCCCTGCTGTTTTTAGCTGGAGG - Intronic
995744951 5:115393597-115393619 TTGCTCCTCTCTGCAGCTGGTGG + Intergenic
997062768 5:130526850-130526872 TCAATACTCCTTTCAGCTGGTGG + Intergenic
999242383 5:150135502-150135524 TTACCCCTCTTGTCAACTGGAGG - Intronic
999708839 5:154298267-154298289 TCCTTCCTCTTTTCAGGAGGTGG + Intronic
1003479302 6:6516615-6516637 TCTCTCCTCTTGCCAGCTTGTGG - Intergenic
1005072226 6:21872311-21872333 TTCCTCCTCTTTTCTGCTGCAGG + Intergenic
1007072185 6:39045995-39046017 TCCCTCCTCTTAACATCTGGGGG - Intergenic
1009898846 6:69786272-69786294 TCATTCCTATTTTCAAATGGTGG - Intronic
1012531493 6:100243526-100243548 TGACTCCTCTTTTCCTCTGATGG - Intergenic
1013572411 6:111442231-111442253 ACACTCCTCTTTTCAGCATTTGG - Intronic
1013777775 6:113697802-113697824 TCACTCATCTTTTTAACTGTAGG - Intergenic
1014421057 6:121245808-121245830 ACACACCTCTTTTCATCTGTGGG - Intronic
1014512487 6:122341358-122341380 AGACTCCTCTTTTCAGCTTCTGG + Intergenic
1016407967 6:143750977-143750999 TCCTTCCCCTTTTCAGCTGAGGG + Intronic
1017655435 6:156623572-156623594 TCACTCCTCTTTTCTCAAGGTGG - Intergenic
1018194137 6:161339824-161339846 TCCCTCCTCTGCTCAGCTGTAGG + Intergenic
1018931180 6:168241405-168241427 TCATTCCTCATCTCAGCTGGTGG + Intergenic
1020849088 7:13326964-13326986 CCACTCCTATTTTCAGCTCTAGG - Intergenic
1022801037 7:33777604-33777626 TCACTCTTTTTTCCAGCAGGTGG + Intergenic
1024529683 7:50381108-50381130 TCACTTTTTTTTTAAGCTGGCGG - Intronic
1024637259 7:51301065-51301087 TCACTCCTCATCTCAGCGTGCGG - Intronic
1027346991 7:77271003-77271025 TCACACTTCTTTGCAGCTGGGGG - Intronic
1028736908 7:94224153-94224175 TCTCTCCTCTTTTCAGATATGGG - Intergenic
1031293857 7:119976869-119976891 TGTCTCCTGCTTTCAGCTGGAGG - Intergenic
1032068376 7:128789749-128789771 TCCCCCTCCTTTTCAGCTGGGGG - Intergenic
1032815636 7:135471072-135471094 TCATTCCACTATTCGGCTGGTGG + Intronic
1033312775 7:140273752-140273774 GCACTCCTCTTTCCAAATGGTGG + Intergenic
1033842483 7:145391831-145391853 TCACTCTAGTTTTCAGATGGTGG + Intergenic
1036153875 8:6324188-6324210 TCACTCCTCTCATCAACAGGTGG + Intergenic
1037122582 8:15306575-15306597 TCTCTCCTCTTTTCACCTGATGG + Intergenic
1037219874 8:16505334-16505356 TGACTCCTCTTCTCACCTGCTGG + Intronic
1037219877 8:16505373-16505395 TGACTCCTCTTCTCATCTGCTGG + Intronic
1044864079 8:96552183-96552205 TCATTCCTCATTTCACCTGGAGG - Intronic
1045219360 8:100182398-100182420 TCACTCTCCTTTTCCTCTGGTGG + Intronic
1051033714 9:12717085-12717107 TCACTGTTCATTTCAGTTGGAGG - Intergenic
1052830639 9:33212402-33212424 TTACTCCACTTTACAGCTGGAGG - Intergenic
1054784616 9:69199120-69199142 AAAGTCCTCTTTTCATCTGGAGG + Intronic
1056693499 9:88827525-88827547 TATCTCCTCTTTTCAGCAAGTGG + Intergenic
1056970447 9:91196555-91196577 TGACCCCTCTTTCCTGCTGGGGG + Intergenic
1058684011 9:107465159-107465181 TCACTCCCACTGTCAGCTGGCGG - Intergenic
1060640872 9:125237729-125237751 TAACTGCTGTTTTCAGATGGAGG - Intronic
1186017646 X:5215726-5215748 TCACTACTCTTTTCAGCCACTGG - Intergenic
1186193351 X:7087337-7087359 TCCTGCCTCTTTTCAGCTGCTGG - Intronic
1186406797 X:9311623-9311645 CAACTCCTCTCTGCAGCTGGAGG - Intergenic
1189083609 X:37997945-37997967 TAGCTCCTCTCTGCAGCTGGTGG - Intronic
1191071973 X:56410569-56410591 TCGCTGCTCTTTAGAGCTGGCGG + Intergenic
1194623275 X:96198694-96198716 AGACTCCTCTTTTCATCTGTAGG - Intergenic
1197971609 X:132120576-132120598 TCCCTCCTCCTTTCAGCTGTGGG + Intronic
1199350927 X:146798754-146798776 TCACTCCACCTTTCAGCAGCAGG - Intergenic