ID: 1097711834

View in Genome Browser
Species Human (GRCh38)
Location 12:62925644-62925666
Sequence ATGTAGCTCTTCAGCCACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097711834_1097711837 11 Left 1097711834 12:62925644-62925666 CCCCTGTGGCTGAAGAGCTACAT 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1097711837 12:62925678-62925700 AACATGTAATACTCATTTATTGG 0: 1
1: 0
2: 2
3: 21
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097711834 Original CRISPR ATGTAGCTCTTCAGCCACAG GGG (reversed) Intronic
904631472 1:31845975-31845997 ATGTGGCTCTTCAGCCAAGGTGG - Intergenic
904911947 1:33941256-33941278 TTGCTGCACTTCAGCCACAGAGG - Intronic
907482513 1:54754737-54754759 ATGTAGCTCAACAGCCAGACGGG - Intergenic
910347407 1:86255744-86255766 ATGGAGCCCCTCAGCCAGAGTGG - Intergenic
911556780 1:99354630-99354652 ATGCAGCTCCTCACCCACAACGG + Intergenic
915577155 1:156786978-156787000 AGGCAGCTCTTCAGGGACAGTGG - Exonic
916953416 1:169806238-169806260 ATGTAGCTCTCAAGCCAAATTGG + Intronic
916967088 1:169959074-169959096 TAGCAGCTTTTCAGCCACAGAGG - Intronic
921133535 1:212239873-212239895 ATGTAACTATCCAGCCATAGGGG + Intergenic
921481851 1:215673036-215673058 ATACAGCTCTGCAGCTACAGTGG + Intronic
1064758546 10:18594743-18594765 ATGTAGGCAGTCAGCCACAGTGG - Intronic
1068916956 10:62443076-62443098 ACGTAGCTCTCTAGCTACAGTGG + Intronic
1070478960 10:76862197-76862219 ATGTAGCTGGTCTGCCACTGTGG - Intergenic
1070625712 10:78049669-78049691 AAGGAGGTCTTCACCCACAGTGG + Intronic
1072800379 10:98388622-98388644 TTGTCGCTCTACAGCCACAGTGG + Intronic
1073903867 10:108254309-108254331 CTGAAGCTCTTGAGTCACAGTGG + Intergenic
1075774379 10:124970738-124970760 AGGTAGCCTTCCAGCCACAGTGG - Intronic
1075875944 10:125805607-125805629 ATTTAGTTCTTCAGTCACACTGG - Intronic
1076013660 10:127010503-127010525 ATTTAGTTCTTCAGTCACATTGG + Intronic
1076059961 10:127406154-127406176 AGGTAGATCTCCATCCACAGGGG - Intronic
1079416169 11:20238395-20238417 AGGTACCTGCTCAGCCACAGTGG - Intergenic
1081113001 11:39160371-39160393 ATGTAGCTCTTCAAACAAAAAGG + Intergenic
1084495847 11:69502612-69502634 GTGGAGCTCTGCAGCCAGAGTGG - Intergenic
1084673973 11:70623710-70623732 AATTAGCTCCTCAGCCACACTGG + Intronic
1088117765 11:106332105-106332127 ATGTATCTAGCCAGCCACAGTGG - Intergenic
1090586700 11:128220974-128220996 AGGTGGCTCTTGATCCACAGAGG - Intergenic
1091197163 11:133741153-133741175 CTTTCTCTCTTCAGCCACAGGGG + Intergenic
1091968568 12:4766056-4766078 ATGTAACTCGCCAGGCACAGTGG - Intronic
1097618442 12:61911003-61911025 ATGTAACTCTTCAGCCATGCAGG - Intronic
1097711834 12:62925644-62925666 ATGTAGCTCTTCAGCCACAGGGG - Intronic
1099491386 12:83292687-83292709 ATGTACCAGCTCAGCCACAGTGG + Intergenic
1102007402 12:109597326-109597348 ATGGAGCTCTTCAGCAATGGAGG + Exonic
1102738667 12:115186407-115186429 ATGCAGCTCTTGAGCATCAGGGG + Intergenic
1103858022 12:123988059-123988081 TTGTAGTCCTTCAGCCACTGTGG + Exonic
1104680530 12:130748156-130748178 ATGCAGGCCTCCAGCCACAGGGG + Intergenic
1105066636 12:133206446-133206468 ATGTAGCTATAGAGTCACAGTGG + Intergenic
1107386510 13:39915608-39915630 CTCTACCTCTTCAGCCACAGGGG + Intergenic
1109622700 13:64929929-64929951 ATGAATCTCTTCCCCCACAGAGG - Intergenic
1111052751 13:82906693-82906715 AGGCAGGTCTTCAGCCACTGAGG + Intergenic
1111658766 13:91183073-91183095 ATGTGACTCATCTGCCACAGTGG - Intergenic
1114776100 14:25483424-25483446 ATGTAGTTCTTTAGTCACACAGG - Intergenic
1115090722 14:29571347-29571369 ATGTAGCCTTTCAGCCACCAGGG - Intergenic
1115422293 14:33210072-33210094 ATATAGCTGTACATCCACAGAGG - Intronic
1117189849 14:53278831-53278853 GAGTAGGTCTTCAGCCACTGAGG - Intergenic
1117384257 14:55195031-55195053 AGGTACCAGTTCAGCCACAGAGG - Intergenic
1117844945 14:59900965-59900987 TGTTAGCTCTTCAGCCACACAGG - Intergenic
1120439659 14:84520406-84520428 AGGTACCTGTTCAGCCACAGAGG - Intergenic
1121375951 14:93410961-93410983 ATGTACCAGCTCAGCCACAGGGG + Intronic
1121851928 14:97229160-97229182 ATGTTGAGCTTCAGCCACACTGG - Intergenic
1122202503 14:100131058-100131080 ACCTAGCTCTCCAGGCACAGGGG - Intronic
1125920707 15:43523926-43523948 ATGTTCCTCTTCAGCCAAAGGGG - Exonic
1127173493 15:56328434-56328456 ATGTACCAGCTCAGCCACAGTGG + Intronic
1127202359 15:56669540-56669562 ATGTAGTTCCTTAGTCACAGTGG - Intronic
1127609947 15:60627075-60627097 CTGTTACCCTTCAGCCACAGAGG - Intronic
1127891497 15:63255702-63255724 ATGGAGCTCTTCAGAGAGAGAGG - Intronic
1128694322 15:69748886-69748908 ACCTAGCTTTTCAGCCAGAGAGG - Intergenic
1129037948 15:72662285-72662307 TTGTAGCTGTTCCACCACAGAGG - Exonic
1129211941 15:74074946-74074968 TTGTAGCTGTTCCACCACAGAGG + Exonic
1129398462 15:75266138-75266160 TTGTAGCTGTTCCACCACAGAGG - Exonic
1129402070 15:75290414-75290436 TTGTAGCTGTTCCACCACAGAGG - Exonic
1129729067 15:77919260-77919282 TTGTAGCTGTTCCACCACAGAGG + Intergenic
1132590124 16:722960-722982 AAGTTGCTCTTCAGCCATCGTGG + Exonic
1133589315 16:7227515-7227537 CTGCAGCTCTTCAGACGCAGTGG + Intronic
1133999305 16:10770198-10770220 ATGCAGCTCTTGGGGCACAGGGG - Intronic
1137332196 16:47509592-47509614 ATTAAGCTCTTCAGTCACAATGG - Intronic
1137702310 16:50506162-50506184 AGGCAGATCTTCAGCCCCAGAGG - Intergenic
1138053381 16:53806612-53806634 ATGCAAATCTCCAGCCACAGGGG - Intronic
1141908718 16:87044179-87044201 ACTCAGCTCTTCAGCCAGAGGGG - Intergenic
1147389055 17:40098322-40098344 ATGTGCCTCTGCAGACACAGTGG - Intronic
1147627442 17:41909227-41909249 ACATAGCTCTTCAGCCACTGAGG + Intronic
1149179870 17:53922406-53922428 ATGTACCTCTGCAGCCACTTAGG - Intergenic
1149229722 17:54519035-54519057 ATGCAGCTCTTCAGCCGCCCAGG + Intergenic
1149516267 17:57283315-57283337 AGGAAGCACTTCAGCCCCAGGGG - Intronic
1149630233 17:58116110-58116132 AGGGTGCTATTCAGCCACAGGGG - Intergenic
1153967820 18:10197401-10197423 ATGAAGCTCTGCAGGCAGAGAGG - Intergenic
1156409934 18:36817908-36817930 TTGTTACTCTACAGCCACAGTGG + Intronic
1158174325 18:54637331-54637353 ATGTAGCCTTCCGGCCACAGTGG + Intergenic
1158899971 18:61953522-61953544 AAGTAGCTCTGCAGGCTCAGAGG - Intergenic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
1166241907 19:41500178-41500200 GTGCAGCTCTGCAGCCGCAGAGG - Intergenic
1202673915 1_KI270710v1_random:23242-23264 ATGTAGCTCCTCACCAGCAGTGG - Intergenic
925381893 2:3434016-3434038 GGGTAGCTCTTCAGAGACAGGGG + Intronic
926077726 2:9954941-9954963 ATGAAGCACTTTATCCACAGCGG + Exonic
929208038 2:39320792-39320814 AGGTAGCATTTCACCCACAGAGG - Intronic
932694695 2:73945637-73945659 ATGTAGCGCCTCATCCACACAGG + Intronic
933299797 2:80528858-80528880 TTGTAGCTCTTCAGTCCCTGAGG + Intronic
935134800 2:100290726-100290748 ATGTGGCTCCTCAGCCACCTTGG + Intronic
935902921 2:107811552-107811574 ATGCAGCTCTGCTGACACAGAGG - Intergenic
936449130 2:112620306-112620328 TTGCAGCTGTGCAGCCACAGGGG - Intergenic
936529489 2:113265943-113265965 ATGGAGCACTCCAGACACAGAGG + Intronic
936901326 2:117484970-117484992 AGGTACCTGCTCAGCCACAGTGG - Intergenic
939346717 2:140975461-140975483 CTTTAGCTCTTCAGGCAGAGAGG - Intronic
940320278 2:152369637-152369659 ATGTACATGTCCAGCCACAGAGG - Intronic
942703476 2:178740531-178740553 AAGTACTTCCTCAGCCACAGAGG + Exonic
944659423 2:201908616-201908638 ATGAAGCTCGCCAGGCACAGTGG + Intergenic
948220713 2:236267581-236267603 ATGCAGCTCTGCATCCAAAGAGG + Intergenic
1169610003 20:7368021-7368043 ATTCAGGTCCTCAGCCACAGAGG + Intergenic
1185221206 22:49630059-49630081 ATATGGCCCTTGAGCCACAGAGG + Intronic
950457421 3:13101014-13101036 TTGCAGCTCTTCAGACACATGGG - Intergenic
950884319 3:16349333-16349355 ATCCATCTCTACAGCCACAGTGG - Intronic
951681716 3:25301762-25301784 ATTTATGGCTTCAGCCACAGTGG + Intronic
952013554 3:28930791-28930813 ATGCACCTCTCCAACCACAGTGG - Intergenic
952946717 3:38482744-38482766 ATGTAGCAGTTCAGTCAAAGTGG - Intronic
956330286 3:68099553-68099575 ATGAATTTGTTCAGCCACAGTGG + Intronic
963192297 3:142486352-142486374 ATGTACCTAATCAGCCACACAGG + Intronic
964021772 3:152021830-152021852 AGGTACCAGTTCAGCCACAGGGG + Intergenic
964721671 3:159773083-159773105 ATTCATCTCTTCAGCGACAGAGG - Intronic
964810095 3:160654255-160654277 AGGTATCAGTTCAGCCACAGTGG + Intergenic
964910040 3:161770074-161770096 TTGGAGCCCTTCATCCACAGTGG - Intergenic
964931250 3:162026980-162027002 ATTAAGTTCTTCAACCACAGTGG - Intergenic
966081818 3:176014086-176014108 ATGCAGCTCTTCTGCAACTGTGG - Intergenic
969368990 4:6719126-6719148 ATGTAACACATCAGCCAAAGGGG + Intergenic
972006362 4:34113103-34113125 ATTTATCTATTCAGCCCCAGTGG + Intergenic
973053919 4:45630504-45630526 ATGTACCAGATCAGCCACAGTGG + Intergenic
974399508 4:61385397-61385419 ATGTAATCCTGCAGCCACAGTGG + Intronic
982857782 4:160407091-160407113 ATGCAGCTCTTCAGTACCAGCGG - Intergenic
984843081 4:184086435-184086457 AAGTAGATCTGCAGCCCCAGTGG - Intergenic
985892073 5:2723978-2724000 GTGGAGCTCTTCTGCCACTGTGG - Intergenic
988959074 5:36350941-36350963 ATGTATCTCCTCTCCCACAGTGG - Intergenic
989147556 5:38263930-38263952 CTGTAGCTCTCAAGCTACAGTGG + Intronic
991225849 5:64270767-64270789 ATGTAGCTTTTCAGTTACTGAGG + Intronic
994264634 5:97700316-97700338 AGGTACCACCTCAGCCACAGGGG + Intergenic
1007076027 6:39066700-39066722 TTGGAGCTTTTCAGCCCCAGTGG + Intronic
1008667539 6:53731104-53731126 ATGTAACATTTCTGCCACAGTGG - Intergenic
1009974202 6:70655567-70655589 ACTCAGCTCTTCTGCCACAGGGG - Intergenic
1010313725 6:74420528-74420550 AGGTAACTGTTCAGCCACAGTGG + Intergenic
1012808615 6:103928387-103928409 ATGTAGCTCATCATCCAAAAGGG + Intergenic
1016293643 6:142550935-142550957 ATGTATCTCTTCTGCCAGTGGGG - Intergenic
1026255574 7:68708303-68708325 ACATAGCTCTTCAGGCACATAGG + Intergenic
1028693142 7:93676617-93676639 TTGTAGCACTTCCACCACAGAGG - Intronic
1028903522 7:96127496-96127518 ATGTAGCTTTTTAGCAAAAGTGG - Intronic
1029100300 7:98124359-98124381 ATGGGGCTCATCAGGCACAGTGG + Intronic
1029853169 7:103485971-103485993 TTGTATTTCTTCACCCACAGTGG - Intronic
1033383016 7:140842279-140842301 ATGAAGCAATTCAGGCACAGAGG - Intronic
1036843503 8:12145279-12145301 ATGTAACTCTATAGACACAGGGG + Intergenic
1039551574 8:38446939-38446961 ATGTAGGTCTTTGGCAACAGTGG + Intronic
1043909282 8:85841975-85841997 TTTTAGCTCTTCAGCCCCACAGG + Intergenic
1044213777 8:89582935-89582957 AAGTATCTCTTCAGTCATAGAGG + Intergenic
1044661381 8:94594415-94594437 ATGTAGGACTTCAGCCCTAGGGG + Intergenic
1045054982 8:98361196-98361218 ATGAAGCTCTTCAGCCTCCAAGG - Intergenic
1046557298 8:115790748-115790770 AGGTACCACCTCAGCCACAGTGG + Intronic
1047062991 8:121248975-121248997 AGGGAGCCCTTCAGCGACAGAGG + Intergenic
1047933637 8:129753650-129753672 AGGTACCAGTTCAGCCACAGTGG + Intronic
1047944879 8:129865937-129865959 ATGAATCCCTTCAGCCACATCGG + Intronic
1049178574 8:141208672-141208694 AGCTAGCTCTTCAGCCACCAGGG + Intronic
1053626245 9:39874513-39874535 ATGTTGCTCTTGAGCCTGAGCGG + Intergenic
1053878628 9:42568720-42568742 ATGTTGCTCTTGAGCCTGAGTGG - Intergenic
1053894038 9:42725658-42725680 ATGTTGCTCTTGAGCCTGAGCGG + Intergenic
1054217643 9:62376188-62376210 ATGTTGCTCTTGAGCCTGAGCGG - Intergenic
1054233062 9:62532975-62532997 ATGTTGCTCTTGAGCCTGAGCGG + Intergenic
1054263703 9:62898022-62898044 ATGTTGCTCTTGAGCCTGAGCGG + Intergenic
1056190568 9:84180506-84180528 ATGAGGCTCTCCAGGCACAGAGG + Intergenic
1059524599 9:114978960-114978982 ATGCAGTTCTTCTGCAACAGAGG + Intergenic
1060196973 9:121630033-121630055 ATGTAGATGATCAACCACAGTGG + Intronic
1062675888 9:137743642-137743664 ATGAAGCTCCTCTGCCATAGGGG + Intronic
1187479192 X:19639548-19639570 ATGCAGATCTTAAGCCACACGGG + Intronic
1188458251 X:30392048-30392070 ATTAAGCTCTTAACCCACAGGGG + Intergenic
1189606234 X:42681107-42681129 CGGTATCTCTTCAGCCAGAGGGG - Intergenic
1189640836 X:43068570-43068592 ATGTGCCACTTCAGCCACAGTGG + Intergenic
1193366248 X:80637396-80637418 AGGTACCAGTTCAGCCACAGTGG - Intergenic
1196654361 X:118201559-118201581 ATGTAGCTCTGCTTCCAAAGAGG - Intergenic
1199845270 X:151688361-151688383 ATGTACCAACTCAGCCACAGTGG + Intergenic