ID: 1097712842

View in Genome Browser
Species Human (GRCh38)
Location 12:62934518-62934540
Sequence TCATCCTCAAGGAGACTCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097712842_1097712852 1 Left 1097712842 12:62934518-62934540 CCGCCGAGTCTCCTTGAGGATGA 0: 1
1: 0
2: 2
3: 3
4: 79
Right 1097712852 12:62934542-62934564 GATGGGGCGGGCGATGTGGTCGG 0: 1
1: 0
2: 1
3: 10
4: 228
1097712842_1097712851 -3 Left 1097712842 12:62934518-62934540 CCGCCGAGTCTCCTTGAGGATGA 0: 1
1: 0
2: 2
3: 3
4: 79
Right 1097712851 12:62934538-62934560 TGAGGATGGGGCGGGCGATGTGG 0: 1
1: 0
2: 1
3: 51
4: 518

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097712842 Original CRISPR TCATCCTCAAGGAGACTCGG CGG (reversed) Exonic
902455634 1:16532132-16532154 TCATTTTCTAGGAGGCTCGGAGG + Intergenic
902659716 1:17892633-17892655 TCTTCCCCAAGGAGGCTGGGTGG + Intergenic
907770209 1:57454489-57454511 CCATCCTCAAGTAGACCCCGGGG - Intronic
911110018 1:94173970-94173992 TCAACCTAAAGAAGACTCTGAGG - Exonic
917133089 1:171762180-171762202 TCATTGTCAAGGAGACTCAGTGG + Intergenic
920295570 1:204954233-204954255 TCCTCCTCATGGACACCCGGGGG - Exonic
924162403 1:241246244-241246266 TCACCCTCAAGCAGACTCTGTGG - Intronic
1065147090 10:22780626-22780648 TCATCCCCAGGGAGACTGTGTGG - Intergenic
1069620906 10:69836740-69836762 TCAGCCTCATGGAGACCCTGGGG + Intronic
1074978935 10:118603610-118603632 TCATCCTTAAGGAGACCATGAGG + Intergenic
1077856845 11:6135407-6135429 TCATCCTTAAGGAGATTCATGGG - Intergenic
1079858200 11:25632846-25632868 TCAACATCAAGCAGACTGGGGGG + Intergenic
1081023586 11:37979772-37979794 TCATTCTCACTGAGACTTGGTGG - Intergenic
1081534460 11:43987085-43987107 TCTTCTTGAAGAAGACTCGGGGG - Intergenic
1083332431 11:61905168-61905190 TCCTCCTCAAGGAGGCACTGAGG - Intronic
1089511757 11:119003191-119003213 TCTTCTTCATGGAGACTCAGTGG + Intronic
1090898500 11:131003505-131003527 TTGTCCTCAAGGAGACCCTGTGG + Intergenic
1094484552 12:30914315-30914337 AAATCCACAAGGAGACTTGGTGG + Intergenic
1097712842 12:62934518-62934540 TCATCCTCAAGGAGACTCGGCGG - Exonic
1098409733 12:70168593-70168615 TCATCCTCAAGGAGACTGGCTGG + Intergenic
1103274678 12:119701467-119701489 GCATCCCCAAGGGGACTTGGTGG + Intronic
1104434951 12:128748300-128748322 TCATCCTCAAGGTGTCTGTGGGG - Intergenic
1112387570 13:98954434-98954456 TCTTCCTCCAGGAAACCCGGTGG - Intronic
1115089033 14:29551651-29551673 TCTCCCTCATGGAGACTAGGAGG - Intergenic
1127702429 15:61514303-61514325 TCTTCCTCAAGAAGACTCTCTGG - Intergenic
1136222374 16:28836598-28836620 GCCTCCTCAAGGTGTCTCGGGGG - Intronic
1139612834 16:68071050-68071072 TCTTCCTCAAGGAGGGTCTGCGG + Exonic
1140867320 16:79074623-79074645 TAATCCTCATGGAGACTCTTAGG - Intronic
1146642558 17:34552364-34552386 TCCTCCCCAAGGAGACTCGGTGG + Intergenic
1152288232 17:79424577-79424599 TCCTAGTCAAGGAGACTCAGTGG - Intronic
1153894848 18:9549322-9549344 TCATCCTCAATGACAGTCTGGGG + Exonic
1160911361 19:1475235-1475257 TCATCCTGAAGGGAACTGGGGGG + Exonic
1163233169 19:16017287-16017309 TCATCCTCACGGCGACTCCATGG + Intergenic
1168104769 19:54159990-54160012 TCTTCCGCAAGGAGACTTGTCGG - Intergenic
930416681 2:51098013-51098035 TCACCCTGAAGGACACTCAGTGG + Intergenic
932282161 2:70502895-70502917 TCATTCTCACGGAGACCCTGTGG + Intronic
932743855 2:74314803-74314825 CCAGCCTCAAGGAGACACTGTGG + Intronic
933655174 2:84881039-84881061 TCCTCCTCAAGGCGGCTCCGAGG + Exonic
936398521 2:112148724-112148746 TCATCCTCCAGGAGGCTAGCTGG + Intronic
937318059 2:120944532-120944554 TGATCCCCAAGGTGACTCTGGGG - Intronic
947715953 2:232338929-232338951 TTTTCCTCAAGGAGACACCGTGG + Intronic
1169354717 20:4897015-4897037 GCATCCTCCAGGGGACTTGGTGG - Intronic
1169771035 20:9200742-9200764 TCAGCCTCAAGAAGACTGAGAGG - Intronic
1170524415 20:17224134-17224156 ACATCTTCAAAGAGACTCTGGGG + Intergenic
1171106307 20:22436005-22436027 TCTTCCTCAGGGAGACTTGCTGG - Intergenic
1175446539 20:59024105-59024127 TCATGGTCAAGGACACTAGGTGG - Exonic
1175865764 20:62175501-62175523 GCAGCCTGAAGGAGGCTCGGTGG + Intronic
1180560403 22:16610324-16610346 TTATACTCAAGGCGCCTCGGCGG - Intergenic
1182249990 22:28992485-28992507 TCATGCCCAGGGAGACTGGGGGG - Intronic
952670357 3:35959499-35959521 TAATTCTCCAGGAGACTCGAAGG + Intergenic
954197652 3:49006058-49006080 TCATCCTGAATCAGACTCTGTGG - Exonic
954812181 3:53255270-53255292 TCCTCTTGCAGGAGACTCGGGGG - Intronic
954876273 3:53805052-53805074 TCATCCCCAAGGATTCTTGGAGG + Exonic
969169127 4:5345629-5345651 TCACCCTCCAGGAGACACTGTGG - Intronic
969511343 4:7619714-7619736 TCTCTCTCAAGGAGGCTCGGAGG + Intronic
973089762 4:46120997-46121019 TCATTCTCTAGGAGACTCTTTGG - Intronic
977318994 4:95487182-95487204 TTATCCTCAAGGAGACTAGAGGG - Intronic
984023570 4:174516469-174516491 TCATCCTCAAGTAGACCTTGGGG - Intronic
995526111 5:113051911-113051933 ACATCCCCAAGCAGACTGGGAGG + Intronic
996307313 5:122062668-122062690 TCATCCTTAAGGAGTCTTGCAGG - Intronic
1001401311 5:171448180-171448202 TCATCCTGAGGGAGGCTCTGTGG + Intronic
1001568687 5:172716450-172716472 TCATGCTCAGGGAGGCTGGGAGG + Intergenic
1005475622 6:26204793-26204815 TCATCTACGAGGAGACTCGCGGG + Exonic
1005643999 6:27824273-27824295 TCATCTACGAGGAGACTCGCGGG + Exonic
1005645198 6:27831357-27831379 TCATCTACGAGGAGACTCGCGGG - Exonic
1008594691 6:53029771-53029793 TATTACTCAAGGAGACTGGGTGG - Intronic
1017222612 6:151984018-151984040 TCATCTTCAGGGAGAGTTGGTGG - Intronic
1019385736 7:755035-755057 TCATTTTCAAGCACACTCGGGGG + Intronic
1023313903 7:38915678-38915700 TCATCCTCAAGGTCACTTGTGGG - Intronic
1025209520 7:57012899-57012921 TGATCCTCATGAAGACTGGGGGG + Intergenic
1025662428 7:63563951-63563973 TGATCCTCATGAAGACTGGGGGG - Intergenic
1029724426 7:102392865-102392887 TCATCCTCTTGGGGACTCAGTGG + Intronic
1030779213 7:113577790-113577812 CCAACCGCAAGGAGAATCGGGGG + Intergenic
1036782398 8:11658669-11658691 TAATCCTCAGGGGGACTTGGTGG - Intergenic
1038741869 8:30223613-30223635 TCACCCTAATGGAGACTCAGAGG - Intergenic
1050589295 9:7145886-7145908 TCTTCCTCCAGGACACTCTGAGG + Intergenic
1050889242 9:10803031-10803053 GCATCCTCAGGGAGAATCTGAGG + Intergenic
1051969033 9:22864423-22864445 TCATTCTCAAGCAGTCTCAGAGG - Intergenic
1056597038 9:88016202-88016224 TCATTCTCAAGTAAAATCGGGGG - Intergenic
1061400264 9:130364716-130364738 TCTTCTCCAAGGATACTCGGGGG - Intronic
1061737423 9:132670738-132670760 TCCGCCTCATGGTGACTCGGCGG + Exonic
1062475067 9:136722659-136722681 TCATCCTCAGGGAAGCTCTGAGG + Intronic
1062710285 9:137971731-137971753 TCAGCCTCCAGGAGCCTCTGTGG + Intronic
1187292333 X:17967147-17967169 TCTTCCCCTAGGAGACTGGGGGG + Intergenic
1196886179 X:120247947-120247969 TAATCCTCAAAGTGACTCTGTGG + Intergenic