ID: 1097713135

View in Genome Browser
Species Human (GRCh38)
Location 12:62936385-62936407
Sequence GAGAGTGGCCCAGGTGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097713129_1097713135 7 Left 1097713129 12:62936355-62936377 CCTCGTTCTTCTCAGTCAGTGTT 0: 1
1: 0
2: 1
3: 5
4: 163
Right 1097713135 12:62936385-62936407 GAGAGTGGCCCAGGTGTTGAAGG 0: 1
1: 0
2: 0
3: 23
4: 221
1097713128_1097713135 8 Left 1097713128 12:62936354-62936376 CCCTCGTTCTTCTCAGTCAGTGT 0: 1
1: 0
2: 0
3: 8
4: 150
Right 1097713135 12:62936385-62936407 GAGAGTGGCCCAGGTGTTGAAGG 0: 1
1: 0
2: 0
3: 23
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097713135 Original CRISPR GAGAGTGGCCCAGGTGTTGA AGG Intergenic
900331098 1:2135029-2135051 GACAGAGGCCCAGGTGTGGATGG - Intronic
900806119 1:4769442-4769464 GAGACTGGCCCAGGGTGTGAGGG + Intronic
901731865 1:11285779-11285801 GAGAATGGCCTCGGTGCTGAGGG - Exonic
901940055 1:12655220-12655242 TACAGTGTCACAGGTGTTGATGG - Intronic
902078928 1:13807890-13807912 GGGAGTGGACCAGGTGTTTGAGG + Intronic
902635195 1:17730201-17730223 GGGGGTGGCTCAGTTGTTGAGGG + Intergenic
905101626 1:35528552-35528574 GAGAATGTTCCATGTGTTGATGG + Intronic
907326352 1:53640997-53641019 GAGACAGGCCCAGCTGATGATGG + Intronic
909316517 1:74226439-74226461 GAGAATGACCCAAGTGCTGAGGG - Intronic
911428668 1:97755355-97755377 GAGAGTTGCCCAGGCATGGATGG - Intronic
912949498 1:114111045-114111067 GAGGGAGCCCGAGGTGTTGAAGG - Intronic
917771637 1:178286029-178286051 GAGGGTTACCCAGGTGTTTAGGG - Intronic
918163731 1:181924862-181924884 GAGAGTGGCAAAAGTGTGGAGGG - Intergenic
918825577 1:189319554-189319576 GAGAGCTGCACAGGAGTTGATGG - Intergenic
920819279 1:209365227-209365249 GAGAGTGGGGAAGGTGTCGAGGG - Intergenic
923021217 1:230165662-230165684 GAGAATGTCCCAGCTGTTGAAGG + Intronic
923962032 1:239096675-239096697 TAGAGTGGGACAGGTGGTGATGG - Intergenic
1063672584 10:8111351-8111373 GAGAGTGGGACACGAGTTGACGG + Intergenic
1064581145 10:16794222-16794244 GAAATTGGCCCAGGTGATTATGG - Intronic
1064791372 10:18960660-18960682 GAGAGTCGCCCTGATGGTGAGGG + Intergenic
1065480984 10:26193630-26193652 GAGAGGGGCCCTGGTGTAAATGG + Intronic
1065900936 10:30207352-30207374 CAGGATGGACCAGGTGTTGAGGG + Intergenic
1067038590 10:42936284-42936306 GAGGATGGCCCAGGTGGTCAAGG - Intergenic
1067247648 10:44559719-44559741 AAGAGTGGCCCAGGAGGAGAAGG - Intergenic
1070426820 10:76296971-76296993 GAGAGTCACACAGCTGTTGATGG + Intronic
1070908023 10:80091692-80091714 GATAGTGGGACAGGTGCTGAGGG - Exonic
1073438358 10:103536063-103536085 GTAGGTGGCCAAGGTGTTGATGG + Intronic
1073898708 10:108193718-108193740 GAGAGAGGCTGAGGAGTTGATGG - Intergenic
1075461810 10:122621386-122621408 GAGGGAGCCCCAGGTCTTGAAGG - Intronic
1075671130 10:124264853-124264875 GAGGGTGGCCCTGGTGTCGAGGG - Intergenic
1075735330 10:124661363-124661385 GAGAGAGGCCCAGGAGCAGAAGG + Intronic
1076096873 10:127739356-127739378 CAGAGCGGCCCAGGTGGTGGGGG + Exonic
1076941948 10:133615885-133615907 GGGGTCGGCCCAGGTGTTGATGG + Intergenic
1078532846 11:12150341-12150363 GAGATTGGCCCAGGAGGTCAAGG + Intronic
1078553161 11:12294160-12294182 GAGAGGGGCCCAGGAGAAGATGG + Exonic
1079383646 11:19959982-19960004 GAGACTGGCCCAGATGTTTAAGG + Intronic
1079414159 11:20217408-20217430 GAGAGTGGCTTAGGAGATGATGG - Intergenic
1082014529 11:47474859-47474881 GAGTTTGGCCCATGAGTTGATGG - Intronic
1083880243 11:65544841-65544863 GAGAGTGGACCAGGAGACGAGGG - Intronic
1085689122 11:78651327-78651349 GAGAGTGGCTGAGGTGGTGTGGG + Intergenic
1085819706 11:79779507-79779529 GGGAGTGCTCCAGGTGTTGAGGG + Intergenic
1086945290 11:92838712-92838734 GTGAGTGGGCCAGCTCTTGAGGG + Intronic
1088349142 11:108865165-108865187 GAGAGTGGCCCTGGTGTGTTAGG + Intronic
1088534086 11:110840729-110840751 GAGAGTAGGCCAGGTGGAGACGG + Intergenic
1088918217 11:114242977-114242999 GAGGCTGGGCCAGGTGCTGAGGG + Intronic
1089519695 11:119055725-119055747 GAGGGTGGCCCCCGTGTTAAGGG - Intronic
1089744353 11:120606651-120606673 GAGAGTGCCGCAGGTGTTGGGGG + Intronic
1089784531 11:120898584-120898606 GAGAGTGTCCGAGATGTTGGAGG - Exonic
1090851732 11:130576591-130576613 GAGAGTGAGACAGGTGTGGATGG + Intergenic
1091729068 12:2866392-2866414 GACATTGGACCAGGTGTTTAAGG - Exonic
1091773067 12:3165951-3165973 CAGATTTGCCCAGGTGTGGATGG + Intronic
1092934086 12:13343816-13343838 AAGAGTAGACCAGGTTTTGAGGG - Intergenic
1093473426 12:19529203-19529225 TAGAGAGGACCAGTTGTTGAGGG + Intronic
1094780640 12:33788782-33788804 GAGAGTGGAGCAGGGGTGGAAGG - Intergenic
1096589532 12:52648472-52648494 GGGAGAGGCCCAGGAGTAGACGG - Intronic
1096651641 12:53064807-53064829 GGGAGGGGGCCAGGGGTTGAAGG + Exonic
1097226271 12:57478360-57478382 GAGAGTGGCTGAGGTGGTGCGGG - Intronic
1097713135 12:62936385-62936407 GAGAGTGGCCCAGGTGTTGAAGG + Intergenic
1098076557 12:66738078-66738100 GAGAGAAGCACAGGTGTTGAAGG + Intronic
1099297065 12:80841432-80841454 GAGATTGGTCCAGCTCTTGAGGG - Intronic
1100396328 12:94189215-94189237 GAGAGTGGCCAGGGAGCTGAGGG + Intronic
1101580928 12:106040336-106040358 GAGGGAGGCTGAGGTGTTGAGGG - Intergenic
1102178354 12:110892936-110892958 AAGAGGGGCCCAGGTGTTTGGGG + Intronic
1104639985 12:130461188-130461210 GAGCCTGGCCCAGGGGTTGTAGG + Intronic
1106658871 13:31777290-31777312 AGGAGTAGGCCAGGTGTTGAGGG + Intronic
1110394786 13:75016770-75016792 GAGAGTGACACAGTTGTTGGAGG + Intergenic
1110974424 13:81811365-81811387 GAGAATGGTCCAGGTACTGAGGG - Intergenic
1110974527 13:81813012-81813034 GAGAATGGTCCAGGTACTGAGGG + Intergenic
1113051923 13:106221774-106221796 CAGAGTGGCACAGGTGCTGGGGG - Intergenic
1115731373 14:36272993-36273015 GAGGGTGGTCCAGGTCTTCAGGG + Intergenic
1120037560 14:79715364-79715386 CAGAGAGACCCAGGTGGTGATGG + Intronic
1121200123 14:92109774-92109796 CAGAGAGGACCAGGTGCTGAAGG + Intergenic
1121877400 14:97465929-97465951 GGGAGTGGCCCCTCTGTTGATGG + Intergenic
1121884961 14:97534597-97534619 GAGAGTGGCCCAAGGTTTCAGGG - Intergenic
1122741226 14:103872497-103872519 GAGTTTGGCCAAGCTGTTGATGG - Intergenic
1123013175 14:105359043-105359065 CAGTGTGGCCCAGGTGTCCAGGG + Intronic
1124120663 15:26885794-26885816 GACAGAGGCCGAGGTGTTGGAGG + Intronic
1126633333 15:50758992-50759014 GTGAGTCACCCAGGAGTTGAAGG - Intronic
1128497589 15:68207159-68207181 CAGAGTGGCCCAGGGTTTCAAGG - Exonic
1128865882 15:71115202-71115224 GAGAGTGGCCCAGCTGGCCAGGG - Exonic
1128991024 15:72260501-72260523 GAGGGAGGCCCACGTGCTGAGGG + Exonic
1129666489 15:77582250-77582272 GAGAGAGGTCCAGGTGAAGAGGG - Intergenic
1129910337 15:79221370-79221392 GAGAGAGGCCCAGAGTTTGAGGG - Intergenic
1130769918 15:86914066-86914088 GAGTGTAGCCCTGGTCTTGAAGG + Intronic
1131611673 15:93970913-93970935 AAGAATGGCACAGTTGTTGAAGG + Intergenic
1135533183 16:23272100-23272122 GAGAGAGGGCGAGGTGTTGGGGG - Intergenic
1137812932 16:51370355-51370377 GAGAGGAGGCCAGGTGATGATGG - Intergenic
1138581287 16:57942166-57942188 GAGAGTGGGCCAGGCGTGGTGGG - Intronic
1139215862 16:65123437-65123459 GAGACGGGCCCAGGAGTTAACGG + Intronic
1139573388 16:67826995-67827017 GACAGTAGCCCAGCTGCTGAAGG + Exonic
1139638402 16:68273450-68273472 GTGACTGGCACAGGAGTTGAGGG + Intronic
1139884004 16:70196097-70196119 CAGGGTGGGCCAGGTGTTGTAGG + Intergenic
1141067710 16:80927395-80927417 GAGAGCGGCCCACGTGTTGGAGG + Intergenic
1141462108 16:84183717-84183739 GGGAGAGGCCCAGGGGTTGCCGG + Exonic
1142645170 17:1307080-1307102 CGGAGTGGTCCAGGTGTGGAAGG + Intergenic
1147230783 17:39016261-39016283 GAGAGGGGCCCAGCTGGAGACGG - Intergenic
1148823962 17:50378513-50378535 GAGAGTGGCCCAGGTCTTCTGGG - Intronic
1148862593 17:50612446-50612468 GAGAGTGGAGCTGGTGTTGGAGG - Intronic
1150388169 17:64776450-64776472 GGGAGGGGCACAGGTGATGAGGG - Intergenic
1150791284 17:68201501-68201523 GGGAGGGGCACAGGTGATGAGGG + Intergenic
1151847970 17:76671454-76671476 GAGGGTGGCCCAGGGTTTCAGGG - Intergenic
1152920496 17:83064227-83064249 GGGAGTGGCCCACCTGTGGAGGG + Intergenic
1157220269 18:45824593-45824615 GAGAGTGACCAAGAAGTTGAAGG + Intergenic
1157654863 18:49375145-49375167 GTGAGAGCCCCAGGTGTTTAGGG - Intronic
1158436172 18:57436598-57436620 GAGTGTGGCCCGGGTGGTGCAGG - Exonic
1160225732 18:77009490-77009512 GGGAGTGGCTCTGGTATTGAGGG - Intronic
1160405504 18:78643840-78643862 GAAAGTGGCCCAGGAGCAGAGGG + Intergenic
1160489463 18:79325062-79325084 GAGAGGGGCTCAGGGGTTGTGGG - Intronic
1161619526 19:5290880-5290902 GGGAGTGACCCAGGTGTCCAGGG - Intronic
1162860991 19:13505836-13505858 GAGAGAGACCCGGGGGTTGATGG - Intronic
1163062138 19:14768445-14768467 GAGAGGGGCACAGATGCTGATGG + Intronic
1163388799 19:17016948-17016970 GTCTGTGGCCCAGGGGTTGAGGG - Intronic
1164000336 19:21092501-21092523 GATAGTGGCCCAGGTGGGGCTGG - Intronic
1165700380 19:37932847-37932869 AAGAGTGGGCCGGGTGTTGACGG + Intronic
1166175776 19:41068545-41068567 CAGATTTGCCCAGGTTTTGATGG - Intergenic
924961039 2:34931-34953 GAGAGTGGCCCACGCCTTCAGGG - Intergenic
927638122 2:24830748-24830770 GAGCATGGCCCAGGTGTTCCTGG + Exonic
929006710 2:37401749-37401771 GAAAGTTGCCTAGGTTTTGAGGG - Intergenic
929415473 2:41742921-41742943 GAGAGAGGTCCAGTTTTTGAAGG - Intergenic
929454040 2:42054059-42054081 GGGAGTGGGCCAGGTGGTGGAGG - Exonic
929610625 2:43268434-43268456 GAGAGTGGCTCTGGTGGTGGCGG - Intronic
929953999 2:46441401-46441423 GACAGTGGCCCCTGTTTTGATGG + Intronic
930283848 2:49403616-49403638 GCAAGTGGGCCTGGTGTTGAGGG - Intergenic
931490645 2:62742613-62742635 AAGAATGGCCCAGGAATTGAAGG + Intronic
931878666 2:66542753-66542775 TAGAGTGGCCAAGGTGGTGAGGG + Intronic
933297524 2:80507287-80507309 AAGAGTTGCCTAGGTGATGATGG - Intronic
933648656 2:84831758-84831780 GAAGGTTGCCCAGGGGTTGAGGG - Intronic
933712890 2:85340682-85340704 GAGAGTGGCGCTGCTGTTGTTGG - Intergenic
935569407 2:104642996-104643018 GAGAGTGGCCCAGGGGCTCTTGG + Intergenic
936230094 2:110692899-110692921 GGGAGTTACCCAGCTGTTGAGGG + Intergenic
943295206 2:186129644-186129666 GAGCTTGGCCCAGGAGATGATGG + Intergenic
944518061 2:200532116-200532138 GAACGTGACCCAGGAGTTGAGGG + Intronic
947651437 2:231789617-231789639 GAGAGTGGCCCCGGAGTTCTTGG + Intronic
947831614 2:233145666-233145688 GAGAGTGGCTCAGATCTTGGTGG + Intronic
947930744 2:233963193-233963215 GAGAGTAGCCCATGTTTGGAGGG - Intronic
948072680 2:235140449-235140471 GAGAGTGGAGCAGGTGCTGGAGG - Intergenic
948882894 2:240869367-240869389 GGGAGAGGCCCAGGTGGGGATGG + Intronic
1169277190 20:4241747-4241769 GAGAGTCGGCCAGGTGCTAAAGG - Intronic
1170547727 20:17449311-17449333 GAGGGTGGCCCTGGAGCTGAAGG - Intronic
1172413659 20:34745711-34745733 GAGAGTGGCCTAAGTGTGAAGGG + Intronic
1174107490 20:48172907-48172929 GAGAGTGTGCCAGGAGTGGAGGG + Intergenic
1175798081 20:61784970-61784992 CAGCGTGGCTCAGGTGTAGAAGG - Intronic
1175805134 20:61823238-61823260 GATAGTGGCGATGGTGTTGATGG + Intronic
1175919970 20:62446201-62446223 CAGAGGGGCACAGGTGCTGAGGG + Intergenic
1175919999 20:62446275-62446297 CAGAGGGGCACAGGTGGTGAGGG + Intergenic
1175920014 20:62446312-62446334 CAGAGGGGCACAGGTGGTGAGGG + Intergenic
1175962891 20:62646039-62646061 GAGAGTGGCCCAGCTGTGCCAGG + Intronic
1176206211 20:63889563-63889585 GAGAGTGGACTAGGGGTTGCCGG - Intronic
1177834572 21:26173940-26173962 GAGAATGGCCAAGGTGTGGAAGG - Intergenic
1181040256 22:20188660-20188682 CAGGCTGGCCCAGGTGTGGAGGG - Intergenic
1181928032 22:26376046-26376068 GACATTGTCCCAGGTGTTGAGGG + Intronic
1183482639 22:38073663-38073685 GAGGCTGGCGCAGGTGTTCAGGG - Intronic
1184133251 22:42530455-42530477 GAGTGTGGCTCAGGTCTTGTGGG + Intergenic
1184249610 22:43252724-43252746 GAGAGCAGCCCAGATGGTGAGGG - Intronic
949781443 3:7693373-7693395 GAGAGAGGAGCAGGTGATGAGGG - Intronic
950371873 3:12537654-12537676 CAGTGTGGCCCAGGGGTTAAGGG + Intronic
950533491 3:13566569-13566591 GGGAGTGGCCCACGTGGTGAGGG - Intronic
951366015 3:21783540-21783562 TAGAGTGTCCCAGGTGTTTGAGG - Intronic
951413206 3:22390608-22390630 GAGAATGACACAGGTGCTGAAGG - Intergenic
951867696 3:27325889-27325911 AGGAGGGGCCAAGGTGTTGATGG - Intronic
953536101 3:43778041-43778063 GAGAGTGACCAAGGTGGTAATGG + Intergenic
954259558 3:49428842-49428864 GAGAGTGGGCTAGGTTTTGCTGG - Intronic
954290767 3:49648855-49648877 GGCAGTGGCCCAGCTGTGGAGGG - Intronic
954693754 3:52409832-52409854 GAGAGCGACCCAGGTGAGGAGGG - Exonic
954797103 3:53167106-53167128 GAGAGAGGCCCATCTGTTCAAGG + Intronic
957302630 3:78412043-78412065 GAGAATGTCCCAGGGGCTGAAGG - Intergenic
961479799 3:127172328-127172350 GAGAGAGGCCCATGTGTCGGGGG - Intergenic
962605182 3:137026871-137026893 AAGAGTAGCCCAGGGGTAGAAGG + Intergenic
962938385 3:140102700-140102722 CAGATTCACCCAGGTGTTGATGG + Intronic
965159455 3:165113278-165113300 GGGAGTGGCTCATGTGATGATGG + Intergenic
969043059 4:4316200-4316222 GACAGAGTCCCAGGTGCTGAGGG + Intronic
969636254 4:8370862-8370884 GGGAGTGCCCCAAGGGTTGATGG - Intronic
969671286 4:8591758-8591780 GTGAGTGGCCCACCTGTTGAGGG - Intronic
974599719 4:64061973-64061995 GTGAGTGGACCAGCTGTTTAGGG + Intergenic
974965820 4:68759822-68759844 GAGAGGGGCCATGGGGTTGAGGG + Intergenic
976053942 4:81040665-81040687 GAAAGTAACCCAGATGTTGAGGG - Intronic
978062197 4:104351997-104352019 GAAAGTGACCCATGAGTTGAGGG + Intergenic
978378768 4:108104706-108104728 GAGATAGGCCCAGGAATTGAGGG - Intronic
982771847 4:159403645-159403667 CAGAGAGGCCAGGGTGTTGATGG - Intergenic
988823986 5:34915989-34916011 CAGAGTAGCCCGGGTGTTAACGG + Exonic
992866160 5:80959340-80959362 GAGAGTGGCCCAAGTGTTCCCGG - Intergenic
994202898 5:96999068-96999090 GAGTGGGGCCCAGTTGTAGAAGG + Intronic
996011551 5:118486353-118486375 GAGACTGGCTCATGTGATGAGGG - Intergenic
997401387 5:133605872-133605894 GAGTGTGGGGCAGGTGCTGATGG - Intronic
997628901 5:135351463-135351485 GAGATCGGCCCATATGTTGAGGG - Intronic
997878679 5:137571015-137571037 CAGGGTGGCCCAGGTGGGGAGGG + Intronic
998154560 5:139777169-139777191 GAGGGTTGCCCAGGAGATGAAGG - Intergenic
999130196 5:149276893-149276915 GACAGTGGTCCAGTTATTGAAGG - Intronic
999230779 5:150060702-150060724 GAGATGGGCCCAGGAGTTTAAGG + Intronic
999305885 5:150519361-150519383 GAGAGTTGCCCAGGTCTAGATGG - Intronic
999528113 5:152430640-152430662 TAGAGTGGCGGAGGTGATGAGGG + Intronic
1001148455 5:169205031-169205053 GAGAGGGGCCCAGGAATTGAGGG + Intronic
1004347823 6:14864656-14864678 GAGGGTGGCCAGGTTGTTGACGG - Intergenic
1005612718 6:27542139-27542161 GAGCGTGTCCCAGTTGTTGCGGG - Intergenic
1006079340 6:31556278-31556300 CAGAATGGCCCAGGTGTGGCTGG - Intronic
1006298117 6:33179050-33179072 GTGAGTGCCCCAGGGGTGGATGG - Intronic
1007927011 6:45657952-45657974 GGCAGTGGCCCAGCTGTTGATGG - Intronic
1007951580 6:45877258-45877280 GCCAGTGGCCCAGGTGATAAAGG - Intergenic
1008015250 6:46511372-46511394 GAGAGAAGCCCAGGTTTTGGAGG - Intergenic
1008875192 6:56318454-56318476 AAGAGTGGTGAAGGTGTTGAAGG - Intronic
1016987240 6:149904772-149904794 GAGAGTGGGCCAGCTGTGAAAGG + Intergenic
1017566189 6:155689810-155689832 GAAAGTAGCCCAGGTCTTCAGGG + Intergenic
1018902176 6:168057172-168057194 GAGAGTGGCCCTGGTCTCGCAGG + Exonic
1022244347 7:28543815-28543837 GGGAGTGGGCATGGTGTTGAGGG + Intronic
1022467663 7:30662361-30662383 GGGCATGGGCCAGGTGTTGAGGG - Intronic
1022547183 7:31200360-31200382 GAGAGTAGCCAAGGTGGGGATGG - Intergenic
1023816126 7:43951359-43951381 GAAAGAGGCCCAGGTGTGGCAGG + Intronic
1023832439 7:44047509-44047531 GAGAGTGAAGCAGGTGCTGAAGG - Intronic
1024281342 7:47722102-47722124 GAAAGTGTCCCAGGTGTGTAAGG - Intronic
1026895984 7:74010353-74010375 GAGAGAGCCCCAGGAGTTCAGGG + Intergenic
1026896676 7:74013553-74013575 GAGAGAGCCCCAGGAGTTTAGGG + Intergenic
1028918546 7:96286406-96286428 CAGAGTGCCACAGGTGTGGAGGG - Intronic
1032027262 7:128453834-128453856 TAGCCTGGCCAAGGTGTTGAAGG + Intergenic
1034737628 7:153443794-153443816 AAGACTGTCCCAGGTGTTTAGGG + Intergenic
1035234134 7:157485318-157485340 GAGTGTGGGCCGGGTTTTGAAGG + Intergenic
1035318342 7:158012129-158012151 GAGAGAGTCCCACGTGTTGGGGG + Intronic
1035822576 8:2610405-2610427 GAGAGTGCACCTGGTGATGATGG + Intergenic
1035833565 8:2725016-2725038 GAATGTGGCACAGGAGTTGAGGG + Intergenic
1037380728 8:18282910-18282932 CAGAGTGGCCCAAGTTTTCAGGG + Intergenic
1037966365 8:23136878-23136900 GAGACTGGACCAGGGTTTGATGG - Exonic
1042448003 8:68911094-68911116 GAGACTGGGCCAGTTATTGAAGG + Intergenic
1045246948 8:100450688-100450710 AGGAGAGGCCCAGGTGTTGAAGG - Intergenic
1048026727 8:130593814-130593836 GAGAGTGTCCCGTGTGTTGCAGG + Intergenic
1048852688 8:138659705-138659727 GAGGGTGTCCCAGGAGATGAGGG + Intronic
1048871641 8:138804032-138804054 TAGAGGGGCCCAGGAGCTGAGGG - Intronic
1049041049 8:140112046-140112068 GAAAGTGGCCAAGTTGATGAAGG - Intronic
1049640094 8:143711560-143711582 GAGGCTGGCCCAGCTGTGGACGG - Intronic
1056769484 9:89466436-89466458 TAGCGTGTCCCAGGTGTTGTAGG - Intronic
1058426866 9:104882957-104882979 GAGAGTAGCCCAGGTGTCTGGGG - Intronic
1058818698 9:108709360-108709382 CAGAGAGGCCCAGGTGGTGAAGG - Intergenic
1060108997 9:120893355-120893377 CAGAGGGGCCCTGGTGTGGAGGG - Intronic
1060393591 9:123300059-123300081 GTGAGTGGCGCAGGGTTTGAGGG - Intergenic
1061033167 9:128099067-128099089 CAGGGAGGCCCAGGAGTTGAGGG + Intronic
1062050915 9:134446627-134446649 GATCCTGGCCCAGGTGTGGAGGG + Intergenic
1062059356 9:134486628-134486650 GAGAGTGGCCCAGGCAGGGAAGG + Intergenic
1187354395 X:18553234-18553256 GAGACAGGCCCAGGTTTTGTAGG + Intronic
1189100678 X:38186226-38186248 TGGAGTGGCCCATGTGTTGAGGG + Intronic
1189226759 X:39419724-39419746 GAAAGGGGCCCAGCTGTTTATGG + Intergenic
1189990026 X:46585574-46585596 GAGGGTGGGCCAGGTGTGGTGGG - Intronic
1192874540 X:75214469-75214491 GAGAGTGGAATAGTTGTTGAAGG + Intergenic
1193464814 X:81835454-81835476 GAGACTGGCTCCGGTGTTGTTGG + Intergenic
1195464398 X:105164304-105164326 GAGAGTGACCAATGTGTTGAGGG + Intronic
1198230770 X:134687006-134687028 AAGAGTGGCACAGGATTTGAGGG - Intronic
1198258358 X:134944862-134944884 GAGACTGGCTCAGGCCTTGACGG + Intergenic
1200098799 X:153678096-153678118 TAGAATGACCCAGGTGGTGATGG - Intronic