ID: 1097716465

View in Genome Browser
Species Human (GRCh38)
Location 12:62971613-62971635
Sequence CTGAGAAATGAAAAGGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097716465_1097716470 23 Left 1097716465 12:62971613-62971635 CCCTCAACCTTTTCATTTCTCAG No data
Right 1097716470 12:62971659-62971681 TTTCCATCTGTTTAAATCTCTGG No data
1097716465_1097716468 -4 Left 1097716465 12:62971613-62971635 CCCTCAACCTTTTCATTTCTCAG No data
Right 1097716468 12:62971632-62971654 TCAGAGTCTCCTACTTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097716465 Original CRISPR CTGAGAAATGAAAAGGTTGA GGG (reversed) Intergenic
No off target data available for this crispr