ID: 1097720867

View in Genome Browser
Species Human (GRCh38)
Location 12:63019785-63019807
Sequence CTGGGCAAACGGATGGTATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097720860_1097720867 30 Left 1097720860 12:63019732-63019754 CCTTTATTAAGCAGCACTTAAAT No data
Right 1097720867 12:63019785-63019807 CTGGGCAAACGGATGGTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097720867 Original CRISPR CTGGGCAAACGGATGGTATA GGG Intergenic
No off target data available for this crispr