ID: 1097726896

View in Genome Browser
Species Human (GRCh38)
Location 12:63085746-63085768
Sequence GTATTAACCCAGATATTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097726896_1097726898 19 Left 1097726896 12:63085746-63085768 CCACCAAATATCTGGGTTAATAC No data
Right 1097726898 12:63085788-63085810 TAAATATTTACTCACCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097726896 Original CRISPR GTATTAACCCAGATATTTGG TGG (reversed) Intergenic
No off target data available for this crispr