ID: 1097728283

View in Genome Browser
Species Human (GRCh38)
Location 12:63099314-63099336
Sequence AACCCCTGACCTTAGTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097728283_1097728289 6 Left 1097728283 12:63099314-63099336 CCTCTCAACTAAGGTCAGGGGTT No data
Right 1097728289 12:63099343-63099365 GCTGGGAAGGAAAACAGAAGGGG No data
1097728283_1097728288 5 Left 1097728283 12:63099314-63099336 CCTCTCAACTAAGGTCAGGGGTT No data
Right 1097728288 12:63099342-63099364 AGCTGGGAAGGAAAACAGAAGGG No data
1097728283_1097728290 11 Left 1097728283 12:63099314-63099336 CCTCTCAACTAAGGTCAGGGGTT No data
Right 1097728290 12:63099348-63099370 GAAGGAAAACAGAAGGGGCAAGG No data
1097728283_1097728292 23 Left 1097728283 12:63099314-63099336 CCTCTCAACTAAGGTCAGGGGTT No data
Right 1097728292 12:63099360-63099382 AAGGGGCAAGGAAGAGGAGTTGG No data
1097728283_1097728286 -7 Left 1097728283 12:63099314-63099336 CCTCTCAACTAAGGTCAGGGGTT No data
Right 1097728286 12:63099330-63099352 AGGGGTTTACATAGCTGGGAAGG No data
1097728283_1097728291 17 Left 1097728283 12:63099314-63099336 CCTCTCAACTAAGGTCAGGGGTT No data
Right 1097728291 12:63099354-63099376 AAACAGAAGGGGCAAGGAAGAGG No data
1097728283_1097728287 4 Left 1097728283 12:63099314-63099336 CCTCTCAACTAAGGTCAGGGGTT No data
Right 1097728287 12:63099341-63099363 TAGCTGGGAAGGAAAACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097728283 Original CRISPR AACCCCTGACCTTAGTTGAG AGG (reversed) Intergenic
No off target data available for this crispr