ID: 1097728292

View in Genome Browser
Species Human (GRCh38)
Location 12:63099360-63099382
Sequence AAGGGGCAAGGAAGAGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097728277_1097728292 28 Left 1097728277 12:63099309-63099331 CCCTCCCTCTCAACTAAGGTCAG No data
Right 1097728292 12:63099360-63099382 AAGGGGCAAGGAAGAGGAGTTGG No data
1097728278_1097728292 27 Left 1097728278 12:63099310-63099332 CCTCCCTCTCAACTAAGGTCAGG No data
Right 1097728292 12:63099360-63099382 AAGGGGCAAGGAAGAGGAGTTGG No data
1097728283_1097728292 23 Left 1097728283 12:63099314-63099336 CCTCTCAACTAAGGTCAGGGGTT No data
Right 1097728292 12:63099360-63099382 AAGGGGCAAGGAAGAGGAGTTGG No data
1097728282_1097728292 24 Left 1097728282 12:63099313-63099335 CCCTCTCAACTAAGGTCAGGGGT No data
Right 1097728292 12:63099360-63099382 AAGGGGCAAGGAAGAGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097728292 Original CRISPR AAGGGGCAAGGAAGAGGAGT TGG Intergenic
No off target data available for this crispr