ID: 1097732268

View in Genome Browser
Species Human (GRCh38)
Location 12:63141784-63141806
Sequence ATCTATAGGCAAATGATAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097732268 Original CRISPR ATCTATAGGCAAATGATAGT AGG (reversed) Intergenic
906888809 1:49684328-49684350 ATCTTTATGCAAATGAAACTGGG - Intronic
909122755 1:71625170-71625192 TTTTAGAGGCACATGATAGTGGG - Intronic
909289143 1:73860012-73860034 ACATATAGACAAATGCTAGTAGG - Intergenic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910211473 1:84797956-84797978 ATCTATATGCAAAACATAATTGG - Intergenic
916860350 1:168797156-168797178 ATATATAGTCAATTGATTGTGGG - Intergenic
918548852 1:185716848-185716870 ATCTATAGGCATAAGAAATTGGG + Intergenic
918793999 1:188868790-188868812 AACTAAAGGCAAATGATAAATGG + Intergenic
1064241867 10:13637692-13637714 ATCTATTGGGCAAAGATAGTTGG - Intronic
1067959549 10:50832997-50833019 ATCTATCAGCTAATGATACTGGG - Intronic
1068232924 10:54194540-54194562 AACTATATGTAAAAGATAGTTGG - Intronic
1069022870 10:63508273-63508295 AAATATAGTCAAATGATCGTTGG - Intergenic
1070725768 10:78788162-78788184 ATATTTAGGTAAATGATGGTCGG - Intergenic
1070944341 10:80376341-80376363 ATCAATAGGCAAATGTGACTGGG + Intergenic
1072132095 10:92504189-92504211 TTCTAAAGTCAAATGATAGAGGG - Intronic
1072479678 10:95798557-95798579 ATCTTTAGGGAAAGGATAGCTGG - Intronic
1077448891 11:2622070-2622092 ATCTTCAGACAAATGACAGTGGG - Intronic
1078066854 11:8084233-8084255 TTCTTTAGAGAAATGATAGTTGG + Intronic
1078707340 11:13757580-13757602 TTCTATAGGCACATTTTAGTAGG - Intergenic
1081154555 11:39673937-39673959 ATAAATAGGCAAATTGTAGTTGG - Intergenic
1085367429 11:75963369-75963391 CTCTATTGTCAAATGATTGTGGG - Intronic
1090528382 11:127562352-127562374 ATCAATAAGCAAATCATAATTGG - Intergenic
1090562254 11:127945029-127945051 ATCAATATGCAAATTTTAGTGGG + Intergenic
1093755832 12:22850896-22850918 CTTTATAGGCACAGGATAGTGGG + Intergenic
1094583123 12:31752604-31752626 ATTTATAGGCATATGACAGGGGG + Intergenic
1097565283 12:61261893-61261915 ATTTCTATGGAAATGATAGTTGG - Intergenic
1097732268 12:63141784-63141806 ATCTATAGGCAAATGATAGTAGG - Intergenic
1099444797 12:82740062-82740084 ATATATATTCAATTGATAGTAGG - Intronic
1099776096 12:87133475-87133497 ATCTATAGGCTAATTAATGTGGG + Intergenic
1105784153 13:23731681-23731703 ATGAGTAGACAAATGATAGTTGG + Intronic
1106112395 13:26788303-26788325 ATTTTTAGGCAAATGATGGATGG + Intergenic
1107855568 13:44612184-44612206 ATATACAGGCAAATGAAAATTGG + Intergenic
1108286058 13:48909026-48909048 TTATATAAGCAAATGGTAGTTGG + Intergenic
1111876758 13:93906710-93906732 ACCTAAAGGGAAATGACAGTTGG - Intronic
1116115133 14:40638499-40638521 ATTTATAGGCAAATAGAAGTGGG + Intergenic
1116183161 14:41561444-41561466 CTCTATAGGCAAATGGTTTTTGG - Intergenic
1116375037 14:44188248-44188270 ATCTAGAGACAATTGATATTTGG - Intergenic
1116894407 14:50301962-50301984 ATCACTAAGCAAATGCTAGTTGG + Intronic
1120197331 14:81499272-81499294 ATCTACATGTAAATGAAAGTTGG - Intronic
1128421943 15:67500492-67500514 ATCTGTAGACAAATGCCAGTTGG + Intronic
1136033750 16:27522399-27522421 ATCTATGGTCAAATGATTCTCGG - Intronic
1143172111 17:4936335-4936357 ATCTATAGGCTTGTGATAGTTGG - Intergenic
1143296046 17:5872967-5872989 ATCTATGGGCAGTTGAGAGTGGG + Intronic
1153723479 18:7931815-7931837 AAATATAGGCAAATAATATTTGG - Intronic
1160104666 18:75961947-75961969 TCCTAGAGGTAAATGATAGTTGG - Intergenic
1165536685 19:36453547-36453569 ATCTATTAGCAAATGATTGTAGG - Intronic
925432688 2:3809329-3809351 ATCTACATGCTAATGATATTGGG + Intronic
926271633 2:11371153-11371175 AACTAGAGGCAGATGATATTGGG + Intergenic
935828391 2:106974245-106974267 ATCTGTAGGCAAATGAAGGAAGG + Intergenic
939047185 2:137263662-137263684 ATCTATATACAAATGAAATTAGG - Intronic
941573279 2:167198248-167198270 ATTTATAGGCAAAGGGTATTTGG + Intronic
941731920 2:168927352-168927374 CTCTATTGGCAGATGATAGATGG - Exonic
941746190 2:169089172-169089194 ATCTAGGGGCTAATGACAGTAGG + Intronic
1172513661 20:35517481-35517503 ATCTATAGGAAAATGTAAGAGGG + Exonic
1173022982 20:39283466-39283488 ATCTTCAGCCAAATGATAGAAGG - Intergenic
1173083056 20:39888050-39888072 ATGTAAAGCCAAATGATAATTGG + Intergenic
1173843949 20:46176516-46176538 ATGTATAGGTAAATGATGATGGG + Intronic
1177671740 21:24240032-24240054 ATCTAGATGCAAATAATATTAGG - Intergenic
1181474982 22:23162449-23162471 ATGTATAGGCCAATGAGAGAGGG - Exonic
949486783 3:4547436-4547458 ATCTAGAGGGAAATGGAAGTAGG - Intronic
954778525 3:53042319-53042341 ATGGATAGGCAAATCATACTGGG + Intronic
958446244 3:94218577-94218599 ATCTATAGGCTAAAAGTAGTTGG + Intergenic
961630238 3:128293243-128293265 GTGTATAGGCAGATGATAGCAGG + Intronic
962945895 3:140170326-140170348 ATCTATAGACAAAGGATAGAAGG + Intronic
963925097 3:150943360-150943382 ATTTATAGGCAGAGGATAGGTGG - Intronic
965273304 3:166647323-166647345 AATTATATGCAAATCATAGTAGG + Intergenic
966843368 3:184106774-184106796 ATCTTTGGGGATATGATAGTTGG - Intronic
970437865 4:16052823-16052845 AGCCCTAGGCAAATGATTGTTGG + Intronic
970947440 4:21711652-21711674 ATATATAGGCAAATTTTAATTGG + Intronic
972042247 4:34617366-34617388 ATCTAAAAGCAAATGGTATTTGG + Intergenic
972193912 4:36629587-36629609 AACTATAGGCAAAAAACAGTAGG - Intergenic
975129341 4:70817022-70817044 ATTTATAAGCAAGTGTTAGTGGG - Exonic
977220453 4:94332050-94332072 ATTTATAGGCACACGATTGTGGG - Intronic
979151580 4:117323188-117323210 ATCTATAGATAAATAATTGTTGG - Intergenic
980518566 4:133899301-133899323 ATATATAGGTAAATGATAAGAGG - Intergenic
981948739 4:150380356-150380378 TTCAAGAGGAAAATGATAGTGGG - Intronic
984018432 4:174454614-174454636 ATCTATTGGCAATGAATAGTTGG - Intergenic
986797762 5:11228798-11228820 ATCTATATGCTATTGATATTTGG + Intronic
986942408 5:12970253-12970275 ATATATAATCAAATTATAGTAGG + Intergenic
988207654 5:28160766-28160788 TTCTATAGGCCAATCACAGTTGG + Intergenic
988833837 5:35012415-35012437 TTCTTTAAGCAAATGATATTAGG + Intronic
990499650 5:56383277-56383299 AACTATATGCAATTGATAGATGG - Intergenic
993927623 5:93890178-93890200 ATCTAAAAACAACTGATAGTTGG - Intronic
995681467 5:114725618-114725640 ATTTAAAGGCAAATCATGGTAGG - Intergenic
997111238 5:131076822-131076844 ATGAATAGGGAAAAGATAGTTGG - Intergenic
998057783 5:139093753-139093775 ATTTATAGGGTAAAGATAGTGGG - Intronic
999966596 5:156816835-156816857 ATCTAGAAGCAAATCCTAGTTGG - Intergenic
1000530411 5:162412782-162412804 ATCTATAGACAAATAATTGATGG + Intergenic
1001799628 5:174531761-174531783 ATCTGTAGTGACATGATAGTTGG + Intergenic
1003715468 6:8641308-8641330 CTCAATAGGCAAATTATAGAGGG + Intergenic
1005121827 6:22398770-22398792 ACCTGTAGGCAAGTGATAGATGG + Intergenic
1006545724 6:34779793-34779815 ATATATAGGCAAAGGAAAGAAGG - Intergenic
1009632155 6:66213683-66213705 ATCCAGAGGCAGATGATAATGGG + Intergenic
1011004799 6:82632400-82632422 ATCAATAGCCAAAAGATAGTTGG + Intergenic
1015028741 6:128568817-128568839 TTCTATAGGCAAATCATGGCTGG + Intergenic
1015852212 6:137585813-137585835 ATCAATAACCAAAAGATAGTTGG - Intergenic
1016586688 6:145696214-145696236 ATCTTCAGACAAATGATAATGGG + Intronic
1017368435 6:153673534-153673556 ATCTATAGTCAAATAAATGTGGG - Intergenic
1018277867 6:162152433-162152455 ACCTATAGAGAAATGATAGCGGG - Intronic
1018567762 6:165173836-165173858 ACCTATTTGCAAATGATAGCAGG + Intergenic
1020483554 7:8692453-8692475 GTCTATAGGAATATAATAGTTGG + Intronic
1021580561 7:22148469-22148491 ATCTATGTGAAAGTGATAGTAGG + Intronic
1022971072 7:35517935-35517957 ATCTAATTGCAAATGAGAGTGGG - Intergenic
1028026806 7:85853069-85853091 ATTTATGGGCAAATGTTAATAGG + Intergenic
1028798203 7:94929523-94929545 ATTTATAGGCAAAATATTGTTGG + Intronic
1030710592 7:112744234-112744256 ATATATAGGGTAATGATACTTGG - Intergenic
1031402818 7:121345760-121345782 ATTTAAAAGCAAATGATGGTTGG - Intergenic
1032070324 7:128801561-128801583 ATATATAGGAAAATGGTAGAAGG + Intronic
1033061940 7:138118118-138118140 ATCTATAAGCAACTGATCTTGGG - Intergenic
1034698064 7:153072434-153072456 ATCTAAAAGCAAATTATAGAGGG - Intergenic
1034985168 7:155508413-155508435 ATCTACAGCCAAATGACAGAGGG - Intronic
1035046017 7:155966385-155966407 ATATATAGTCAAATGATCTTTGG + Intergenic
1036999579 8:13702559-13702581 ACGTATATGCAAATGATAGAAGG + Intergenic
1039332654 8:36555877-36555899 ATCTAAAGCCAAATGATTTTTGG + Intergenic
1045072561 8:98524146-98524168 ATCTATGGTCAAATGATTTTCGG - Intronic
1045373423 8:101548250-101548272 ATCTAAAGGCAGATGATATTCGG + Intronic
1045707245 8:104939561-104939583 ATCAATAGTCAAAAGATAGCTGG - Intronic
1046254751 8:111681334-111681356 ATATATAGGCAATAGATACTGGG - Intergenic
1048359064 8:133680068-133680090 ATATATAGGCATATGATGGAAGG - Intergenic
1048405883 8:134120193-134120215 ACCTATATGCAAAGTATAGTAGG + Intergenic
1050260504 9:3836501-3836523 ATCTGAAGGCAAAGGAGAGTGGG - Intronic
1053292873 9:36893534-36893556 AACTATGTGCAAATGAAAGTGGG - Intronic
1053438989 9:38098741-38098763 TTCTATAGGCTAATCATAGCAGG - Intergenic
1059722867 9:116978262-116978284 ACCTCTAGGGAAATGCTAGTAGG + Intronic
1185498448 X:577676-577698 ATATATAGGTAGATGATAGATGG + Intergenic
1187482032 X:19666325-19666347 ATCTATAGTCAAAGGTTTGTTGG - Intronic
1188761034 X:34030171-34030193 ATCTACAGTCATATGATATTTGG + Intergenic
1188909417 X:35827181-35827203 ATTTATAGTAAAATGATAGTTGG + Intergenic
1189165390 X:38856027-38856049 AACAGTAAGCAAATGATAGTTGG - Intergenic
1190779722 X:53582139-53582161 AACTTTAGGTAAATTATAGTTGG - Intronic
1191881346 X:65846440-65846462 ATCTATAGGTAAAAGAGAGGTGG + Intergenic
1197126630 X:122954602-122954624 ACATATGGGCAAATAATAGTAGG + Intergenic
1197570109 X:128139697-128139719 AGCTACAGGCAAATGATTATAGG - Intergenic