ID: 1097732612

View in Genome Browser
Species Human (GRCh38)
Location 12:63146661-63146683
Sequence ACTGAGATGCTGAAGGTGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 6, 3: 21, 4: 292}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097732612_1097732614 10 Left 1097732612 12:63146661-63146683 CCTCTCACCTTCAGCATCTCAGT 0: 1
1: 0
2: 6
3: 21
4: 292
Right 1097732614 12:63146694-63146716 TTCTTGACCAATAATATGTGAGG 0: 1
1: 0
2: 0
3: 18
4: 129
1097732612_1097732617 23 Left 1097732612 12:63146661-63146683 CCTCTCACCTTCAGCATCTCAGT 0: 1
1: 0
2: 6
3: 21
4: 292
Right 1097732617 12:63146707-63146729 ATATGTGAGGAACCAAAAGGAGG 0: 1
1: 0
2: 4
3: 28
4: 228
1097732612_1097732616 20 Left 1097732612 12:63146661-63146683 CCTCTCACCTTCAGCATCTCAGT 0: 1
1: 0
2: 6
3: 21
4: 292
Right 1097732616 12:63146704-63146726 ATAATATGTGAGGAACCAAAAGG 0: 1
1: 1
2: 0
3: 18
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097732612 Original CRISPR ACTGAGATGCTGAAGGTGAG AGG (reversed) Exonic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
902843388 1:19090084-19090106 ACTGAGATGGAGAAGATCAGAGG - Intronic
903014016 1:20350216-20350238 ACGGTGCTTCTGAAGGTGAGTGG + Exonic
903043895 1:20552209-20552231 AATGACATGCTGTGGGTGAGGGG + Intergenic
903367847 1:22815933-22815955 TCTGAGAGGCAGAAGGTGTGTGG + Intronic
903768227 1:25748294-25748316 CCTGGGAAGCTGAAGGGGAGCGG + Intronic
905248604 1:36631776-36631798 ACTGTGTTGGTGAAGATGAGAGG - Intergenic
905448259 1:38041493-38041515 AGTGAGATGCGGAAGGAGATGGG + Intergenic
906494937 1:46298534-46298556 ACTGAGTGGCTGAAGATAAGTGG - Intronic
906946597 1:50300071-50300093 ACTGGCATGCTGGAGGTCAGAGG + Intergenic
908252770 1:62278221-62278243 GCTGACATGGTTAAGGTGAGAGG + Intronic
908796418 1:67834183-67834205 ACTGCGATGCTAAAGGTGATGGG + Intergenic
909551865 1:76907033-76907055 AGTGGGTTGCTGAAAGTGAGTGG - Intronic
911084396 1:93964572-93964594 CCTAAGATGCTGGAGTTGAGAGG - Intergenic
911567250 1:99476799-99476821 ACTGAGATGATAAATGTGAATGG + Intergenic
913260077 1:116989831-116989853 CCTCAGATGGTGAGGGTGAGGGG - Exonic
915689213 1:157671109-157671131 ACTGAGATGCTACAGGTGGGGGG + Intergenic
917028832 1:170667980-170668002 ACAGAATTGCTGATGGTGAGTGG - Intronic
917692953 1:177487724-177487746 CCTGGGATGCTGAAGAGGAGTGG - Intergenic
917901425 1:179546818-179546840 ACTGAGTTGCTGTAGGTATGTGG - Intronic
918897799 1:190370037-190370059 ACTGAGATGGTCAAAGTGTGTGG - Intronic
919362333 1:196610726-196610748 CCTGGGATGCTGGAGGTTAGAGG + Intergenic
919937613 1:202264987-202265009 ATTGAGAGGCTGACAGTGAGGGG + Intronic
920501046 1:206485630-206485652 AACGAGATGCTGTACGTGAGAGG - Intronic
920680025 1:208065092-208065114 GCTGAGAGGCTGCAGGGGAGGGG + Intronic
921364388 1:214359978-214360000 ATGGACATGGTGAAGGTGAGGGG - Intronic
921597646 1:217072190-217072212 ACAGAGATGCTGATGCTGACGGG - Intronic
922603893 1:226877081-226877103 AGTGAGAGGGTGAAGGTGGGTGG + Intronic
923311397 1:232739027-232739049 TTTGGGAGGCTGAAGGTGAGAGG - Intergenic
923462994 1:234223269-234223291 ACTGAGATGGTGATGATGGGTGG + Intronic
923821242 1:237445062-237445084 ACTGAGATGGGCAAGGTGATGGG + Intronic
1063011909 10:2030640-2030662 AGGGAGATGTTGATGGTGAGGGG - Intergenic
1063539565 10:6918567-6918589 ACTGAAATGCTGAGTGTGATTGG + Intergenic
1064887889 10:20132696-20132718 ACTCATATGCTGAAAGTGAAAGG - Intronic
1065529668 10:26655577-26655599 AGTGAGATACTGGAGGTGAGGGG + Intergenic
1065557268 10:26929356-26929378 AGTGAGATACTGGAGGTGGGGGG - Intergenic
1066036351 10:31491119-31491141 ACTGAGATCATGAAAGAGAGAGG - Intronic
1066046610 10:31600864-31600886 TCTGAGAAGCAGGAGGTGAGAGG - Intergenic
1067069392 10:43120830-43120852 ACTGGGAGGCTGCAGGAGAGGGG - Intronic
1067080540 10:43209957-43209979 ACTGAGAGGCTGTAGGGGAAGGG - Intronic
1068941584 10:62686227-62686249 ACTGAGATGATGCAAGTGAAGGG + Intergenic
1070214293 10:74360804-74360826 ACATAGATGCTGAAAGTGAAGGG - Intronic
1070612531 10:77943354-77943376 ACTGAGCTGCTGGAGGAAAGAGG + Intergenic
1071132922 10:82416697-82416719 ACTGAGATGGTCAGGGTGGGTGG - Intronic
1072663981 10:97380791-97380813 CCTGTGATGAGGAAGGTGAGTGG - Exonic
1073779888 10:106825612-106825634 GCTGGGATGCAGAAGGTGATGGG - Intronic
1073864439 10:107785987-107786009 ACTCATAGGCTGAAAGTGAGAGG - Intergenic
1075354074 10:121755317-121755339 ACTGGGATACTGAAGGACAGTGG + Intronic
1075552037 10:123400007-123400029 AGTGAGATAGAGAAGGTGAGTGG - Intergenic
1075709064 10:124521102-124521124 ACTGAAATGCTGGAGGGGCGTGG + Intronic
1076302451 10:129438342-129438364 GCCGAGATGCTGGAGGGGAGAGG + Intergenic
1076792562 10:132785064-132785086 GCCGAGAAGCTGAAGGTGGGCGG - Exonic
1078942701 11:16026031-16026053 ACTGAGAGTCTGGAGCTGAGAGG - Intronic
1079109822 11:17599074-17599096 ACTGAGAATCTGCAGCTGAGGGG + Intronic
1080770931 11:35340699-35340721 TCTGAGATGCCAAAGGGGAGGGG - Intronic
1080944516 11:36956533-36956555 CATGGGATGCTGAAGGTGGGAGG + Intergenic
1081177945 11:39951939-39951961 AGTTAAATGTTGAAGGTGAGCGG + Intergenic
1081297476 11:41409650-41409672 AATAGGATGCTAAAGGTGAGGGG + Intronic
1081329175 11:41783264-41783286 ACTAAAATGCTGAAAGAGAGAGG - Intergenic
1082957384 11:58885010-58885032 CCTGAGTCCCTGAAGGTGAGGGG + Intronic
1083161487 11:60857081-60857103 GCTGAGATGCTGAGGTTGAAGGG - Intergenic
1083983497 11:66193559-66193581 GCTGTGAAGCTGCAGGTGAGTGG + Exonic
1084188779 11:67489441-67489463 ATGGAGATGCTGAAGGTGAGGGG + Exonic
1085618733 11:78021924-78021946 AGTGAGCTTCTGGAGGTGAGGGG - Intronic
1085847698 11:80084657-80084679 AATGAGATGATGAATATGAGGGG + Intergenic
1086923104 11:92610579-92610601 ACTGAGATTTTGAAGGTAAAAGG - Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087733769 11:101808748-101808770 ACTGAGATACTAAAGGAGATTGG + Intronic
1089411137 11:118243805-118243827 ATTTAGAGGCTGAAGGGGAGGGG - Intronic
1091248134 11:134117554-134117576 ACTGGGATGCTGAAGGAAAGTGG - Intronic
1091266945 11:134277924-134277946 AACGAGATCCTGGAGGTGAGGGG - Intronic
1091491569 12:937094-937116 AGTGAGATACAGAAGCTGAGGGG + Intronic
1091617285 12:2059219-2059241 GCTGAGATGCAGAAGGTGAGGGG + Intronic
1092767378 12:11864894-11864916 TCTGGGATGGTGAAGGAGAGAGG - Intronic
1094557684 12:31518118-31518140 TCAGAGAAGCTGAATGTGAGAGG - Intronic
1095279172 12:40329815-40329837 ACTCAGAAGGTTAAGGTGAGAGG - Intronic
1095579370 12:43779289-43779311 ACTGAGATGCAGAAAGTTATAGG + Intronic
1096451381 12:51744951-51744973 TCTAAGATGGTGAAGGTAAGAGG - Intronic
1096972070 12:55674805-55674827 ACTGAGATGATGAAGAAGATGGG + Intergenic
1097405385 12:59183105-59183127 TTTGAGAGGCTGAAAGTGAGGGG + Intergenic
1097437421 12:59568346-59568368 ACTGAGAAGCAGAATGAGAGGGG + Intergenic
1097732612 12:63146661-63146683 ACTGAGATGCTGAAGGTGAGAGG - Exonic
1097903421 12:64896075-64896097 ACTGAGATGAAAAAGCTGAGGGG - Intergenic
1099553104 12:84072942-84072964 ACTGGGATTCTGAAAGTGAAAGG - Intergenic
1102573501 12:113841884-113841906 ACTGAGATGATGCCGGTGTGAGG + Intronic
1103703589 12:122860063-122860085 ACAGACCTGATGAAGGTGAGGGG + Exonic
1103963302 12:124622653-124622675 ACTGAGATGATGAGGAAGAGAGG - Intergenic
1104572760 12:129939375-129939397 ACTGAGATTCTAAAGGACAGGGG + Intergenic
1104708999 12:130971954-130971976 TCTGGGATGTTGACGGTGAGCGG + Intronic
1106005833 13:25769525-25769547 ATGCAGAAGCTGAAGGTGAGAGG - Intronic
1106217412 13:27715522-27715544 AGTGACCTGCTGAAGGGGAGAGG + Intergenic
1107236651 13:38178640-38178662 ACTGAGAGGCATAAAGTGAGAGG + Intergenic
1108297938 13:49043829-49043851 TTTGAGTTGCTGAAGGAGAGGGG - Intronic
1108598721 13:51972462-51972484 GCTGAGATGCTGGAGGACAGTGG - Intronic
1108750863 13:53447138-53447160 ACTGATATTCTTAAAGTGAGGGG - Intergenic
1109792033 13:67261593-67261615 AGTGAGATGCTGAAATAGAGTGG + Intergenic
1110470372 13:75853344-75853366 ACTGTGAAGCTGAAGGGGAATGG - Exonic
1110488466 13:76073630-76073652 ACTTACAGGCTGAAGGTGAAGGG + Intergenic
1111131416 13:83981558-83981580 AATGAGAAGCTGAGGGAGAGGGG - Intergenic
1111901176 13:94201400-94201422 ACTGGGATGCTTAATGTTAGAGG + Intronic
1113937104 13:114000257-114000279 ACTGACAGGCTGCAGGTGCGGGG + Intronic
1114264034 14:21060742-21060764 ACTGAGAGGCTGCAGGAGAAGGG - Intronic
1116050960 14:39802535-39802557 AATGAGATGCTGAAGGCAACAGG - Intergenic
1121693169 14:95892365-95892387 TCTGAGATGCTGCAAGTGCGTGG + Intergenic
1122086724 14:99312787-99312809 ACTAAGATGCCAGAGGTGAGTGG - Intergenic
1122090289 14:99334041-99334063 AGGGGGATGCTGGAGGTGAGGGG + Intergenic
1122208590 14:100160519-100160541 ACTGAGAGGGTGAAGATGAGGGG - Intergenic
1122299979 14:100726093-100726115 ACTGAGATGCTGTGTGTGCGGGG + Intronic
1122343935 14:101046360-101046382 AATTAGATGCTGAGGGTTAGTGG - Intergenic
1126372301 15:47960314-47960336 ACAGAGAAGCTGAAGGTATGAGG - Intergenic
1127489011 15:59444530-59444552 AATGAGCAGCTGAATGTGAGAGG + Intronic
1129463202 15:75710191-75710213 ACTGAAAGGCAGAATGTGAGGGG - Intronic
1129721683 15:77881210-77881232 ACTGAAAGGCAGAATGTGAGGGG + Intergenic
1130520766 15:84658947-84658969 ACTGTGATGCTGGCTGTGAGAGG - Intergenic
1135889839 16:26347177-26347199 ACTGGGAAGCTTAAGGTAAGAGG + Intergenic
1136508890 16:30723784-30723806 GCTGAGATGGGGATGGTGAGTGG - Exonic
1138391303 16:56671752-56671774 CCTGTGCTGCTGAAGGTGTGTGG - Intronic
1138519445 16:57562765-57562787 ACTGAGCAGCTCTAGGTGAGCGG + Intronic
1138535625 16:57658810-57658832 ACTGAGAGTCTCAAGGGGAGGGG + Intronic
1139673178 16:68505536-68505558 TCTCAGAGGCAGAAGGTGAGGGG + Intergenic
1140022632 16:71252940-71252962 ACTGAGATGGTGAAGGCTATAGG + Intergenic
1140802163 16:78498484-78498506 ACTGAGAAGCACAAGGTGTGAGG + Intronic
1142419271 16:89960598-89960620 ACCGAGATGGGGAAGCTGAGGGG + Intronic
1143101292 17:4506173-4506195 GCTGACGTGCAGAAGGTGAGCGG - Intronic
1143830340 17:9645787-9645809 ACTGTGATGGCGACGGTGAGGGG + Exonic
1146490509 17:33278089-33278111 ACTGAGATCAGGAAGATGAGAGG - Intronic
1149512387 17:57254854-57254876 ATTGATGTGGTGAAGGTGAGAGG - Intergenic
1152429013 17:80237089-80237111 ACCGAGATGGTGCAGGTGGGCGG + Exonic
1155420198 18:25647645-25647667 ACTTAGATGAGGAAGGTAAGTGG + Intergenic
1156451111 18:37266921-37266943 ACTGAGATGCTGGTGGTGGGGGG + Intronic
1159000832 18:62973694-62973716 ACTGAGAATCTGAAAGTCAGGGG - Intronic
1159271938 18:66164209-66164231 ACTGACATGTTGGAGGTGGGAGG - Intergenic
1160288813 18:77571726-77571748 CTTGAGATGGGGAAGGTGAGTGG + Intergenic
1160790005 19:918873-918895 ACTCAGAAGCTGGAGGGGAGGGG + Intronic
1162153807 19:8663467-8663489 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1162153825 19:8663525-8663547 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1163142335 19:15358269-15358291 ACAGTGAGGTTGAAGGTGAGGGG - Intronic
1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG + Exonic
1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG + Exonic
925559127 2:5168969-5168991 ACTGATATTATGAAGGAGAGAGG - Intergenic
926229237 2:10990322-10990344 ACTGACACGGTGAAGGAGAGAGG + Intergenic
926332058 2:11833730-11833752 GCTGAGCTGATGATGGTGAGAGG + Intergenic
926349163 2:11979895-11979917 ACTCAGTTGCTGAAGGTGACAGG - Intergenic
927482487 2:23465360-23465382 ACAGAGAGGCAGGAGGTGAGAGG - Intronic
927501843 2:23588390-23588412 CCTGGGAGGCTGAAGGTGGGTGG - Intronic
928273973 2:29881994-29882016 ACTGAGCTGCTGAAGGGCTGAGG - Intronic
929529759 2:42741593-42741615 ATAGAGATGCTCAAGGAGAGGGG + Intronic
930034870 2:47078971-47078993 AGTGAGAGACTGAGGGTGAGCGG - Intronic
930848087 2:55926964-55926986 ACTGAGATGGTGAAGGTGGGTGG - Intergenic
931464213 2:62472631-62472653 ACTCAGATGCTCAAGGTCAAGGG + Intergenic
932548497 2:72741323-72741345 ACTGAACTGCTGAAAGTGAGAGG - Exonic
932794115 2:74680261-74680283 ACTGAGATGCTGGGGGTCACTGG + Exonic
933306740 2:80609842-80609864 ACTGAGAGGATGATGGAGAGCGG - Intronic
934773803 2:96924526-96924548 GGTGAGATGCTTACGGTGAGGGG + Intronic
934884225 2:98010452-98010474 AGTGAGAAGCAGAAGGTGTGTGG - Intergenic
935290284 2:101604443-101604465 AATGAGATCCTGAGGGTGCGAGG - Intergenic
936005562 2:108884010-108884032 ACTGAGATGGCTAAGGTGAAAGG - Intronic
936594325 2:113833354-113833376 ACTGAGTTGCTGGAAGAGAGAGG - Intergenic
938111440 2:128568827-128568849 ACTGAGAACCTGAATGTGAATGG - Intergenic
938645465 2:133325819-133325841 ACTCAAATGCTGAAGTTGGGAGG - Intronic
938977247 2:136491798-136491820 AATGGGATGCTGAAGAAGAGAGG + Intergenic
941417013 2:165233426-165233448 ACTGAGATGCTGAAGTAGAGAGG - Intergenic
942611514 2:177746780-177746802 ACAGAGACTCTGAGGGTGAGAGG + Intronic
945192113 2:207199435-207199457 GATGAGATGCTGAAAGTGAAAGG - Intergenic
947768488 2:232652782-232652804 AGTGAGATGATGAAGATGTGAGG + Intronic
948543246 2:238704693-238704715 ACTGAGAAGCTCAGGGGGAGAGG - Intergenic
1170002662 20:11632371-11632393 ATTTAGATGCTGCATGTGAGTGG + Intergenic
1171151488 20:22830235-22830257 AGTGTGATGCTGAAGAGGAGTGG - Intergenic
1173048003 20:39531067-39531089 ACTGAGCTTCTGAAGGTCAGAGG - Intergenic
1175111915 20:56654418-56654440 AGTGAGATGGAGAAGGTGAAAGG + Intergenic
1175686073 20:61029749-61029771 AAGGAGATTATGAAGGTGAGAGG - Intergenic
1176298736 21:5088512-5088534 ACTGGGGTGGTGAAGGGGAGAGG - Intergenic
1178991161 21:37357983-37358005 ACATAGATGCTGGAGTTGAGGGG - Intergenic
1179858290 21:44173437-44173459 ACTGGGGTGGTGAAGGGGAGAGG + Intergenic
1181465730 22:23109672-23109694 TCTGAGATGCTGAGGGAGACAGG - Intronic
1181907752 22:26212788-26212810 AGTGAGAAGCTGGAGATGAGAGG + Intronic
1182307632 22:29381776-29381798 ACAGAGCTGCAGAAGGTGGGGGG + Intronic
1183594070 22:38799300-38799322 AGTGAGATGCTGGAGGTATGGGG - Intergenic
1184834766 22:47014647-47014669 ACAGGGATGCTGAGGCTGAGAGG + Intronic
1184836708 22:47028295-47028317 ACTGAGATTCTGAGAGTGAGTGG + Intronic
1185067098 22:48638045-48638067 ACTGAGAATCTCAAGGTGTGTGG - Intronic
1185178781 22:49347467-49347489 GATGAGCTGATGAAGGTGAGGGG + Intergenic
1185203938 22:49525989-49526011 AATGAGATGCGGCAGATGAGGGG - Intronic
1185408517 22:50671258-50671280 CCTGAGGTCCTGAAGGTGGGTGG + Intergenic
949128901 3:477834-477856 ACTGAGATGCTAAAACTGATTGG + Intergenic
950887449 3:16374112-16374134 CATGAGATGGTGAAGGTGAAAGG - Intronic
951183176 3:19682507-19682529 ACTGGGATGCTGGAGCTGGGCGG - Intergenic
952230448 3:31424211-31424233 ACTGAAATGGTGATGCTGAGGGG + Intergenic
953533875 3:43762212-43762234 TCTGAGATGATGAGGGCGAGGGG + Intergenic
953792898 3:45962075-45962097 AGTGAGATGGAGAAGGAGAGAGG + Intronic
953874666 3:46659815-46659837 ACTGAGAGGCTGAACATTAGGGG + Intergenic
954801380 3:53189003-53189025 GCTGAGGTGCTGAGGCTGAGAGG - Intronic
954886922 3:53882715-53882737 ACTGAGATGGTGAAAGTGAGAGG - Intergenic
955785879 3:62538426-62538448 ACTGACAGGTTGGAGGTGAGAGG - Intronic
956045973 3:65196266-65196288 ACTGAGATTCTCAAAGTTAGGGG + Intergenic
958083572 3:88778131-88778153 ACTGATATGCTGAAGTTCAAAGG + Intergenic
959469385 3:106731097-106731119 AATGAGATGATGAGGGTGAAAGG + Intergenic
959612068 3:108306158-108306180 ACTGTGATGTTAAAGGAGAGAGG - Intronic
961622266 3:128233658-128233680 AAGGAGATGCTCAAGGTCAGAGG - Intronic
962178909 3:133184764-133184786 ACTGAGAAGCTAAAGGTAACAGG - Intronic
962801473 3:138894562-138894584 ACTGAGATGAAGAAAGAGAGGGG + Intergenic
963942175 3:151106115-151106137 ACTGGGAGGCTGAGGGTAAGGGG - Intronic
964485760 3:157183924-157183946 ACCCAGGTGCAGAAGGTGAGTGG - Intergenic
965516650 3:169629079-169629101 ACTGAGATGAGGGAGGGGAGGGG - Intronic
966076640 3:175943286-175943308 ACTTATAGACTGAAGGTGAGGGG + Intergenic
968128486 3:196177600-196177622 ACAGAGGTGCTCAAGGTGAGAGG + Intergenic
968795965 4:2704657-2704679 ACTCAGATGCTGCTGGTGGGTGG - Intronic
969054228 4:4391577-4391599 ACCGAGAGGTTTAAGGTGAGTGG + Exonic
971210384 4:24610650-24610672 GCTAAGAGGATGAAGGTGAGTGG - Intergenic
972757535 4:42063835-42063857 CATGAGATGCAGAAGCTGAGAGG - Intronic
973131135 4:46649888-46649910 ACTTAGATACTCAAGGTAAGGGG + Intergenic
975190886 4:71460726-71460748 ACTGATATTCTGAAGGAGAAGGG + Intronic
975219447 4:71797412-71797434 ACTGCGAGGCTGCAGCTGAGCGG - Intronic
976416615 4:84783538-84783560 ACTGAGATAAAGATGGTGAGAGG + Intronic
977064847 4:92302552-92302574 CTTGAGATGGTGAAGGAGAGTGG + Intronic
978459710 4:108937560-108937582 ACAGAGATGCTGCAGGTCAAAGG - Intronic
978777341 4:112516688-112516710 AATGAGCTGCTGAAAGGGAGCGG - Intergenic
979741061 4:124151744-124151766 ACTGAGACCCTGAATGGGAGGGG + Intergenic
980978258 4:139631792-139631814 AATGAGATGAAGAAGCTGAGAGG - Intergenic
981811420 4:148780116-148780138 ACTGAGATGCTGATGGTGTGAGG + Intergenic
981819822 4:148873236-148873258 AAAGAGCTGCTGATGGTGAGAGG - Intergenic
982104503 4:151999825-151999847 TCTGAGATCTAGAAGGTGAGAGG - Intergenic
982679575 4:158412825-158412847 ACTGAAATGTTGATTGTGAGAGG + Intronic
983961730 4:173762475-173762497 ACTTATATCCTGAAGGTGGGGGG + Intergenic
984183917 4:176519232-176519254 ACAGAGATGATGAAAGTCAGAGG + Intergenic
985643501 5:1074453-1074475 CCTGAGCGGCTGAAGGTGAGAGG + Intronic
986360535 5:6974100-6974122 ACTGAAATGGTGGAGGTGAGAGG + Intergenic
986418352 5:7550784-7550806 GCTGAGATGCTGAGTGTGAGTGG - Intronic
987295006 5:16542166-16542188 CCTGAGATGAGGAGGGTGAGTGG - Intronic
987496369 5:18650476-18650498 AATGAGATGCTGAATGTAAATGG - Intergenic
988007515 5:25436251-25436273 ACTGGGAAGCAGCAGGTGAGTGG + Intergenic
990741594 5:58918164-58918186 ACTGAGATGTTGGATGTGAAAGG + Intergenic
990927683 5:61047075-61047097 ATTGTGCTGCTGAAGGGGAGGGG - Intronic
991389360 5:66125724-66125746 ACTGAGGTGGTGAAGGTGCAGGG + Intergenic
992175193 5:74142935-74142957 AATTAGATTCTGGAGGTGAGAGG + Intergenic
992721216 5:79563194-79563216 AGTGAGTTGCTAAAGCTGAGAGG - Intergenic
992879908 5:81097553-81097575 ATTGGGCTGCTGAAGGTGGGTGG + Intronic
994165218 5:96601097-96601119 AAGGAGATGTTGAAGGAGAGAGG - Intronic
995952901 5:117738372-117738394 ACTGAGATGGAGAAGATCAGGGG + Intergenic
997406982 5:133657009-133657031 ACTAAGATGGAGAAGATGAGAGG + Intergenic
998880576 5:146641051-146641073 ACTGGGATGATGAAGTTAAGAGG + Intronic
999019289 5:148145523-148145545 ATGGAGATCCTGAAGCTGAGAGG + Intergenic
999270839 5:150295546-150295568 ACTGAAATGCTGGAGGTCACTGG + Intergenic
999727748 5:154450796-154450818 ACAGAGATGCTCAGGGTGAAGGG - Intronic
1001977950 5:176015778-176015800 TCTGGGATGCTGAAGGCGGGAGG - Intronic
1002239469 5:177827984-177828006 TCTGGGATGCTGAAGGCGGGAGG + Intergenic
1004431770 6:15551556-15551578 GCTGAGATGTGGAGGGTGAGTGG - Intronic
1004524177 6:16390788-16390810 TCTGAGATGCTGCAGTGGAGAGG - Intronic
1005519264 6:26584341-26584363 ATTGACATGGTGAAGGTCAGGGG + Intergenic
1005525421 6:26642804-26642826 ACTGAGATGAGGCAGGTGATAGG - Intronic
1007353577 6:41293885-41293907 ACTGAGATCCTGCAGGTCACAGG - Intergenic
1009529900 6:64798954-64798976 ACTGCAATGATCAAGGTGAGGGG - Intronic
1011587706 6:88944561-88944583 TCTGAGATGCTGAAGATGTTGGG - Intronic
1012157225 6:95834594-95834616 CCTGAGAAGCTGAAGTTGAGAGG + Intergenic
1012875612 6:104721847-104721869 TCTGAGAAACTGAAGGTGGGTGG + Intergenic
1013617319 6:111857248-111857270 ACTGTGATGCTGGAGATTAGAGG - Intronic
1013759158 6:113496312-113496334 TCTGGGATGCTGCAGGTCAGGGG + Intergenic
1014013299 6:116501266-116501288 CCTGAGATGCTGAAGCTTGGCGG + Intronic
1014157848 6:118132845-118132867 ACTGAAATGCAGAAGGGGCGGGG + Intronic
1014204645 6:118644599-118644621 CCTGAGATGGGGAAGGTTAGTGG - Intronic
1014402465 6:121007546-121007568 ACTGAGAAGATGAACCTGAGAGG + Intergenic
1015579042 6:134703510-134703532 CCAGAGATGGTTAAGGTGAGTGG + Intergenic
1017075854 6:150617659-150617681 ACAGTGATCCTGATGGTGAGCGG + Intronic
1017230382 6:152067385-152067407 CCTGAGGTGCTGAATGTGAATGG - Intronic
1017530330 6:155284011-155284033 TCTGAGATGCTGAAGGGAGGTGG + Intronic
1017584765 6:155908784-155908806 ACTGAGATGGGGAAGGTTTGGGG + Intergenic
1017588466 6:155952386-155952408 ACTAAGATGTTGAAGGCCAGAGG + Intergenic
1017768376 6:157625409-157625431 AGTCTGTTGCTGAAGGTGAGAGG + Intronic
1020662600 7:10999781-10999803 AATGAGATGATCAAGCTGAGTGG + Intronic
1021427540 7:20519656-20519678 ACTGAGTTCCTGAAGCTCAGTGG + Intergenic
1022509332 7:30925299-30925321 ACTGAGAAGCTGGAAATGAGAGG - Exonic
1022520274 7:31001843-31001865 AATGAGATGCTGATAGTGACTGG - Intergenic
1022893154 7:34721481-34721503 GATGTGATGCTGAAGGTGGGAGG - Intronic
1023913041 7:44568895-44568917 TCTGAGAAGCTTAAGGTGAGTGG - Exonic
1026461704 7:70620476-70620498 ACTGAGATGTGGAAGGAAAGGGG + Intronic
1026800575 7:73397650-73397672 ACTGAGCTGCTGGAGAAGAGGGG - Intergenic
1027450244 7:78323298-78323320 GCTGAGATGCTGAAGGAATGAGG - Intronic
1027883728 7:83875342-83875364 ACTTAAAAGTTGAAGGTGAGTGG - Intergenic
1028107850 7:86901812-86901834 CCTGAGATGCCAAAGGTGAGAGG - Intronic
1028193204 7:87876046-87876068 TCTGGGAAGCTGAAGGCGAGGGG - Intronic
1028204933 7:88005603-88005625 ACACAGATGCTTAAGGTGGGTGG + Intronic
1029482072 7:100819486-100819508 ACTGAGGGCCTGAAGGGGAGAGG - Intronic
1035327906 7:158076682-158076704 TCTCAGGGGCTGAAGGTGAGAGG - Intronic
1035939029 8:3875435-3875457 AGTGAGATGATGTAGGTGAATGG + Intronic
1036987547 8:13553593-13553615 TTTGGGAGGCTGAAGGTGAGAGG - Intergenic
1037022508 8:13991187-13991209 ACTGAGAGTATGAAGCTGAGTGG + Intergenic
1037190556 8:16119467-16119489 TTTGGGATGCTGAAGGTGGGTGG - Intronic
1038912103 8:31976460-31976482 ACTGACATGTTGCATGTGAGTGG + Intronic
1039068080 8:33626810-33626832 ACAGTGATGGTGAAGGAGAGGGG - Intergenic
1039506349 8:38055162-38055184 CGTGAGATGCTGAAGGGCAGAGG - Intronic
1039789958 8:40867594-40867616 ACTGTGCTGCTGTATGTGAGAGG - Intronic
1040876435 8:52157260-52157282 ATGGAGAATCTGAAGGTGAGAGG + Intronic
1041015845 8:53592525-53592547 ACTGAGATGAAGAGGGAGAGAGG + Intergenic
1041248482 8:55911851-55911873 ACTGAGATGGAGAAGATGGGAGG + Intronic
1042604601 8:70532943-70532965 GCTGAGATGCATAGGGTGAGTGG + Intergenic
1043784831 8:84385828-84385850 TCTTAGATGATGAAGGTGAATGG - Intronic
1046553749 8:115750257-115750279 ACTAAGATGCTGAAGAAAAGTGG + Intronic
1048191483 8:132293675-132293697 ACTGAGATGCAGGGGATGAGAGG + Intronic
1049194274 8:141307264-141307286 GCTGAGACGCAGAAGGTGCGGGG + Intronic
1049373085 8:142276963-142276985 ACAGAGATGCACAAGGGGAGGGG + Intronic
1049871031 8:144976635-144976657 TCTGTGATGCTGAATGAGAGAGG + Intergenic
1050959747 9:11713713-11713735 ACTGGGAAGCTGAAGCTTAGAGG - Intergenic
1051938607 9:22475314-22475336 TATGTTATGCTGAAGGTGAGAGG - Intergenic
1053247946 9:36550571-36550593 ACTCAGAAGATTAAGGTGAGAGG + Intergenic
1053319784 9:37086323-37086345 ACAGAGATGCTGAAGTTGATGGG + Intergenic
1053421878 9:37984866-37984888 CCTCAGAGGCTGAGGGTGAGTGG + Intronic
1056502744 9:87225845-87225867 ACTGGCAGGCAGAAGGTGAGTGG - Intergenic
1057719907 9:97523674-97523696 AATGAGATGGTGTAGGTGAGGGG + Intronic
1058067581 9:100566429-100566451 ACTGAGATGAAGAAGGTGGCAGG - Intronic
1058446356 9:105058521-105058543 ACTGAGATCCTGACCGTGACAGG + Intergenic
1060225189 9:121786152-121786174 CCTGAGATGCTGAAGATGCAGGG - Intergenic
1062722654 9:138052487-138052509 AGGGAGATGCTGGAGGTGAGGGG + Intronic
1188027490 X:25226041-25226063 ACACAGTTGCTGCAGGTGAGGGG - Intergenic
1188323840 X:28774830-28774852 ACTGAGATGAGGAAGGCTAGGGG - Intronic
1189589710 X:42498084-42498106 ACTGAGATGCTGGTGGCCAGAGG + Intergenic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1193159431 X:78211400-78211422 AGTGAGTTTCTGTAGGTGAGTGG + Intergenic
1196360209 X:114845498-114845520 ACTGAAATGATGAAGTTTAGTGG + Intronic
1198421309 X:136472771-136472793 CCAGACATCCTGAAGGTGAGTGG - Intergenic
1201156853 Y:11138420-11138442 ACAGAGATGGTGGCGGTGAGGGG + Intergenic