ID: 1097733074

View in Genome Browser
Species Human (GRCh38)
Location 12:63151255-63151277
Sequence TGTCCTCTGCATCACTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 234}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097733067_1097733074 16 Left 1097733067 12:63151216-63151238 CCCTGGAGTTTTATTTTTTCCTC 0: 1
1: 0
2: 5
3: 86
4: 768
Right 1097733074 12:63151255-63151277 TGTCCTCTGCATCACTGTGGAGG 0: 1
1: 0
2: 4
3: 43
4: 234
1097733065_1097733074 22 Left 1097733065 12:63151210-63151232 CCCGCTCCCTGGAGTTTTATTTT 0: 1
1: 0
2: 1
3: 44
4: 428
Right 1097733074 12:63151255-63151277 TGTCCTCTGCATCACTGTGGAGG 0: 1
1: 0
2: 4
3: 43
4: 234
1097733064_1097733074 23 Left 1097733064 12:63151209-63151231 CCCCGCTCCCTGGAGTTTTATTT 0: 1
1: 0
2: 0
3: 19
4: 215
Right 1097733074 12:63151255-63151277 TGTCCTCTGCATCACTGTGGAGG 0: 1
1: 0
2: 4
3: 43
4: 234
1097733071_1097733074 -8 Left 1097733071 12:63151240-63151262 CCCTACGTCGGTGTTTGTCCTCT 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1097733074 12:63151255-63151277 TGTCCTCTGCATCACTGTGGAGG 0: 1
1: 0
2: 4
3: 43
4: 234
1097733068_1097733074 15 Left 1097733068 12:63151217-63151239 CCTGGAGTTTTATTTTTTCCTCT 0: 1
1: 1
2: 9
3: 122
4: 1136
Right 1097733074 12:63151255-63151277 TGTCCTCTGCATCACTGTGGAGG 0: 1
1: 0
2: 4
3: 43
4: 234
1097733063_1097733074 29 Left 1097733063 12:63151203-63151225 CCTACTCCCCGCTCCCTGGAGTT 0: 1
1: 0
2: 1
3: 19
4: 229
Right 1097733074 12:63151255-63151277 TGTCCTCTGCATCACTGTGGAGG 0: 1
1: 0
2: 4
3: 43
4: 234
1097733072_1097733074 -9 Left 1097733072 12:63151241-63151263 CCTACGTCGGTGTTTGTCCTCTG 0: 1
1: 0
2: 0
3: 9
4: 67
Right 1097733074 12:63151255-63151277 TGTCCTCTGCATCACTGTGGAGG 0: 1
1: 0
2: 4
3: 43
4: 234
1097733066_1097733074 21 Left 1097733066 12:63151211-63151233 CCGCTCCCTGGAGTTTTATTTTT 0: 1
1: 1
2: 4
3: 76
4: 868
Right 1097733074 12:63151255-63151277 TGTCCTCTGCATCACTGTGGAGG 0: 1
1: 0
2: 4
3: 43
4: 234
1097733070_1097733074 -3 Left 1097733070 12:63151235-63151257 CCTCTCCCTACGTCGGTGTTTGT 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1097733074 12:63151255-63151277 TGTCCTCTGCATCACTGTGGAGG 0: 1
1: 0
2: 4
3: 43
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097733074 Original CRISPR TGTCCTCTGCATCACTGTGG AGG Intergenic
900425116 1:2574619-2574641 TTTCCTCTCCATCACCGTGACGG - Intergenic
900537924 1:3187942-3187964 TGTCCTCTGCCTCTCGTTGGGGG - Intronic
900558901 1:3294016-3294038 ATTCCCCTGCCTCACTGTGGCGG + Intronic
900820950 1:4888174-4888196 GCACCTCTCCATCACTGTGGTGG + Intergenic
901231788 1:7645736-7645758 TGTCCTCTGCAGCACTGGGCGGG + Intronic
901948410 1:12721967-12721989 AGTTCTCTGCATCTCAGTGGGGG + Intronic
902986087 1:20155139-20155161 TATCCTCTTAACCACTGTGGGGG - Intergenic
903571292 1:24307572-24307594 TTTCCTGTGCCTCCCTGTGGAGG - Intergenic
905878769 1:41450006-41450028 TCCCCTCTCCATCACTGGGGAGG - Intergenic
906057901 1:42930502-42930524 TGTCCTCTGCAAGGCTGTGGGGG + Intronic
909158812 1:72117959-72117981 AGTCATCTGCATCACTTTGCTGG + Intronic
910505831 1:87949319-87949341 TCTCCTCTGGATTACTGTGATGG - Intergenic
911146767 1:94559942-94559964 TTTACTCTGCATCTCTGTGAGGG + Intergenic
911212334 1:95155299-95155321 TGGCCTCTGCATGACTGTGAGGG - Intronic
911287660 1:96016598-96016620 TGTCCTGTGTATCATTGTGCTGG + Intergenic
912606260 1:110992698-110992720 TTTCCTCTGTATGACTCTGGTGG - Intergenic
912815853 1:112827445-112827467 TGTTCTCTCAACCACTGTGGGGG - Intergenic
912980604 1:114368266-114368288 TGTCCTCTTAAGCACTGTGGGGG + Intergenic
913660648 1:121003625-121003647 TCTCCTCTGGGTCACTGGGGAGG + Intergenic
914224769 1:145711383-145711405 TGTACTCTGCATACCTTTGGAGG + Intergenic
918561691 1:185876216-185876238 TGTCATCTGCAGCAACGTGGAGG - Intronic
918647724 1:186921835-186921857 TGTCCTCTTGACCACTGTGGGGG + Intronic
919662442 1:200260509-200260531 TTTGTTCTGCAGCACTGTGGTGG - Intergenic
921747479 1:218754112-218754134 TGTCCTCTTAGCCACTGTGGGGG + Intergenic
922426518 1:225501376-225501398 TGGCCTCTTCATCACTGTTTTGG - Intronic
922471504 1:225879974-225879996 TCTCCTCTGCAGCACTGGCGAGG - Intronic
922569246 1:226623875-226623897 TGACCTCTGTGTCATTGTGGGGG - Intergenic
923649241 1:235857848-235857870 TTTCATATGCATCACTTTGGGGG + Intronic
924444098 1:244112520-244112542 TGTCCTCTGCATAACAGTCCTGG - Intergenic
1064594465 10:16929227-16929249 TGTCCTTTGTGTCTCTGTGGGGG - Intronic
1065602083 10:27379215-27379237 TGTCCTTTGCAGCAATGTGATGG - Intergenic
1066009654 10:31182710-31182732 TGTCCCCTCCATCTCTGTTGTGG - Intergenic
1066389868 10:34970033-34970055 TGCCCTCTTAGTCACTGTGGGGG - Intergenic
1067024112 10:42828486-42828508 TGTGCTCTGCTTCAGTGTGGAGG + Intronic
1067057164 10:43058947-43058969 TGTCCTCAGCAGCGCTCTGGGGG - Intergenic
1067097298 10:43310377-43310399 TGTGCTCTGCCTCACTGGGAAGG + Intergenic
1067440190 10:46304795-46304817 TGCCTTCTGCCTCCCTGTGGTGG + Intronic
1069869768 10:71526082-71526104 GGCCCTCTGCATCGCTGAGGGGG + Intronic
1069939011 10:71940709-71940731 TGTCCTCTTAACCACTGTGAGGG - Intergenic
1070845484 10:79519585-79519607 TGTCTTCAGCCTCACAGTGGAGG + Intergenic
1070928309 10:80240729-80240751 TGTCTTCAGCCTCACAGTGGAGG - Intergenic
1071281699 10:84109718-84109740 TGTCCTCTTAATTACCGTGGGGG - Intergenic
1071555854 10:86600808-86600830 TCTCCTAGGCATAACTGTGGTGG - Intergenic
1071661570 10:87507796-87507818 TCTCCTGTGCTTCACTGTGCTGG - Intronic
1074542726 10:114378837-114378859 TGTCTTAGACATCACTGTGGTGG - Intronic
1075870099 10:125766000-125766022 CTTCCTCTGTGTCACTGTGGTGG - Intergenic
1076125892 10:127973728-127973750 TATCCTCTGCATGCCTGTGAAGG + Intronic
1076860745 10:133138031-133138053 TGGTCTCTGCATCCCTGTGTGGG + Intergenic
1078115267 11:8442478-8442500 TGGCCTCTGCATCCCTATGAGGG - Intronic
1081260606 11:40955414-40955436 TGTTTTCTTCATCACTGGGGGGG + Intronic
1083190484 11:61048451-61048473 TGTGCTTTGCAGCAGTGTGGGGG - Intergenic
1083197120 11:61094980-61095002 TGTCCTCTTAACCACTGCGGGGG - Intergenic
1085861261 11:80238862-80238884 TCTCCTCTGCATTCCTCTGGTGG - Intergenic
1086345054 11:85887472-85887494 GGGCCTCTGCACCACAGTGGTGG + Intronic
1087504534 11:99002656-99002678 TATTCTCTAAATCACTGTGGTGG - Intergenic
1087732348 11:101793231-101793253 TGTCATTTGCATTTCTGTGGTGG + Intronic
1087894603 11:103573325-103573347 TGTTCTCTTAACCACTGTGGCGG - Intergenic
1088529120 11:110788778-110788800 TGTCCCCTATGTCACTGTGGAGG - Intergenic
1089467799 11:118696809-118696831 TGTCCTCTGCCTCACTGTGCAGG + Intergenic
1089610793 11:119667420-119667442 TGTCCTTTGCTTCCCTGGGGAGG - Intronic
1091779009 12:3202086-3202108 TGTCCTCTGTGTGACTCTGGAGG + Intronic
1093288751 12:17298123-17298145 TGTCCTCTTAACCACTGTGGTGG - Intergenic
1094171339 12:27495579-27495601 TTTCCTCTGGATCACCTTGGGGG - Intronic
1097614655 12:61869626-61869648 TGTGCTCTGTTACACTGTGGAGG - Intronic
1097733074 12:63151255-63151277 TGTCCTCTGCATCACTGTGGAGG + Intergenic
1098748100 12:74265570-74265592 TGTCTTCTTAACCACTGTGGGGG - Intergenic
1098956037 12:76690770-76690792 TGTCTTTTTCTTCACTGTGGTGG - Intergenic
1099035461 12:77581919-77581941 TGTCCTTTGCATAACAGTGTGGG + Intergenic
1100610320 12:96186383-96186405 TGCCCTCTTCATCTCTGTGCTGG + Intergenic
1101029780 12:100647338-100647360 TGTCCTCTTAACCACTGTGGGGG + Intergenic
1102944437 12:116973647-116973669 TGTCCTCTTCAGCACTGTCAAGG + Intronic
1103742119 12:123097928-123097950 TGTCCCCTGCATCACTACAGAGG - Intronic
1106052874 13:26207859-26207881 TCTGCTCTGCATCCGTGTGGGGG - Intronic
1106113229 13:26795122-26795144 TGTCCTCCCCATCTCTGAGGGGG - Intergenic
1107491048 13:40880070-40880092 TGTCCTCTTAACCACGGTGGGGG + Intergenic
1109646576 13:65265658-65265680 TGTCCTTTGCAGCAACGTGGTGG + Intergenic
1112498814 13:99926534-99926556 GGGCCTGGGCATCACTGTGGGGG + Intergenic
1112709026 13:102105092-102105114 TGTCCTCTCCATCACAATAGTGG - Intronic
1112876262 13:104043354-104043376 TGTCTTCAGCATAAATGTGGTGG - Intergenic
1113150541 13:107258618-107258640 TGGCTTCTGCATCACCGTGATGG - Intronic
1113808443 13:113123313-113123335 CGTCCTGTGCCTCCCTGTGGTGG - Intronic
1116154050 14:41180889-41180911 TTTCCTCCTCATAACTGTGGGGG - Intergenic
1116536359 14:46036046-46036068 TGTCCTTTGCAGCAACGTGGTGG + Intergenic
1117955480 14:61120259-61120281 TGTCCTCTCAACCACTGTGGGGG + Intergenic
1118110854 14:62717958-62717980 TGTCCTGTGCAGCAATATGGAGG + Intronic
1119062363 14:71488117-71488139 TGCCCTCTGACTCACTGTGTTGG + Intronic
1120088147 14:80298854-80298876 TATCCTCTGCATATCTGTAGAGG - Intronic
1121037415 14:90717900-90717922 TGACATCTGCATCACAGAGGGGG - Intronic
1122945991 14:105009759-105009781 TTTGCTCTGCAACCCTGTGGGGG + Exonic
1123425262 15:20165526-20165548 TGTGCTCTGCTTCAGTGTGGAGG + Intergenic
1123534486 15:21172060-21172082 TGTGCTCTGCTTCAGTGTGGAGG + Intergenic
1124145494 15:27121574-27121596 GGTGCACAGCATCACTGTGGTGG - Intronic
1124373554 15:29116676-29116698 TGCACTCTGCTTCACTGAGGAGG - Intronic
1125608199 15:40953961-40953983 TGCCCAGTGCATCACTGTGATGG + Intronic
1127030637 15:54857792-54857814 TGTCGTTTTCATCTCTGTGGTGG - Intergenic
1127391532 15:58508765-58508787 TGCCCTCTCCAGCACTGTGCAGG + Intronic
1127842554 15:62843745-62843767 TGGCCTTGGCATCACTTTGGAGG - Exonic
1128870590 15:71152624-71152646 TCTCCTCTGCTTCACCCTGGAGG - Intronic
1131576772 15:93600198-93600220 TGTACTCTGTTTCACTGCGGAGG - Intergenic
1131743031 15:95414923-95414945 TGTCCTTCCCATCACTGTGTCGG + Intergenic
1132658265 16:1050235-1050257 TGTTCTCTGCACCACCCTGGGGG - Intergenic
1133269049 16:4601808-4601830 TGTCCACTGGATCCCTGGGGTGG + Intergenic
1133598276 16:7313854-7313876 TGTCCTCCTCCTCACTGTGCCGG + Intronic
1133735438 16:8611426-8611448 TGTGTTCTGCATCACTGGGTGGG + Intergenic
1133741564 16:8655650-8655672 TGTCCTTTGCATCTCTCTTGTGG - Intergenic
1134767694 16:16775127-16775149 TGTCTTCTGCATCACTCACGCGG + Intergenic
1135218881 16:20595870-20595892 TGTCCTTAGAATCACTGGGGTGG + Intergenic
1136384666 16:29916093-29916115 TGTCTCCTGCATTAGTGTGGAGG - Intronic
1136859596 16:33690217-33690239 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
1137029048 16:35505800-35505822 TCTCCTCTTTATCACAGTGGCGG + Intergenic
1137041792 16:35620044-35620066 TGTTCTCTCAACCACTGTGGTGG + Intergenic
1137679406 16:50326482-50326504 TGTCATCTGCATGACCGTGAAGG + Intronic
1139037510 16:62965590-62965612 TGGCCACTGCATCAATCTGGAGG + Intergenic
1140079617 16:71732860-71732882 TGTCCTCTCCTCCACTGTTGAGG - Exonic
1140755047 16:78059310-78059332 TGCCCTCTTAACCACTGTGGGGG + Intronic
1142103625 16:88290185-88290207 TGTACGCTGCACCACTGTCGCGG + Intergenic
1203121102 16_KI270728v1_random:1538396-1538418 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
1142478512 17:204152-204174 TGTGCTCTGCATCCCTAGGGAGG - Intergenic
1146153533 17:30498945-30498967 TGTTCTCTGTCTTACTGTGGTGG - Intronic
1146564689 17:33902497-33902519 TGTCCACTTCAGCACTGTGGTGG + Intronic
1146763943 17:35501887-35501909 TGTTCTCTCAACCACTGTGGGGG - Intronic
1149188135 17:54026482-54026504 TGTCCTTTGCAGCAACGTGGAGG + Intergenic
1149320322 17:55475051-55475073 TGTCCTCTTAAACACTGTGGGGG - Intergenic
1149401155 17:56297175-56297197 TGGCCTCTGAAGCTCTGTGGTGG + Intronic
1150642076 17:66956030-66956052 TGCTCCCTGCATGACTGTGGTGG - Intergenic
1151556197 17:74847921-74847943 TGTCATGTGCCTCACTGTGGTGG - Exonic
1152113395 17:78369891-78369913 CTTCCTCTACTTCACTGTGGGGG + Intergenic
1152676864 17:81645659-81645681 TGGCCTCTGCGACCCTGTGGTGG - Intronic
1153413098 18:4815991-4816013 GGTCCTCTTCCACACTGTGGAGG + Intergenic
1155454721 18:25998814-25998836 TGACCTCTGCATAAATGTTGGGG + Intergenic
1158291707 18:55951669-55951691 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1159777281 18:72618443-72618465 TGTCACATGCACCACTGTGGAGG + Intronic
1161558690 19:4958505-4958527 TGTCCTGTGCATCGGTGTGAAGG + Intronic
1162284718 19:9729594-9729616 TGTCATCTTAACCACTGTGGGGG + Intergenic
1162633442 19:11946504-11946526 TGTCCTCTCAACCACTGTGGGGG + Intronic
1163916478 19:20244951-20244973 TGTCCTCTCAACCACTGTGGGGG - Intergenic
1163943713 19:20517262-20517284 TGTCCTCTTAACTACTGTGGGGG + Intergenic
1163991601 19:21003658-21003680 TGTTCTCTCAACCACTGTGGGGG - Intergenic
1164217536 19:23162971-23162993 TGTTCTCTCAACCACTGTGGGGG + Intergenic
1164305648 19:24002628-24002650 TGTCCTCCCCATCCCTCTGGAGG - Intergenic
1167384097 19:49154022-49154044 AGTCCTCTTCATCACTCTTGTGG + Exonic
1168322972 19:55521414-55521436 TGGCCTTTGCAGGACTGTGGGGG - Intergenic
930517965 2:52432045-52432067 TGTCCTCTTAACCACTGTGGGGG - Intergenic
933058329 2:77702476-77702498 TGTCCTTTGCAACAATGAGGAGG + Intergenic
933203039 2:79472449-79472471 TGACCTCTGAATCACCTTGGTGG + Intronic
933936014 2:87204325-87204347 TGTCCTCTTAACGACTGTGGGGG + Intergenic
934457958 2:94191327-94191349 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
936718263 2:115215991-115216013 TGTCTTCTGCAGCACCATGGAGG + Intronic
936957804 2:118040884-118040906 GGTCACCTGCATCACTGAGGTGG - Intergenic
937939758 2:127275913-127275935 TGTCCTCTGCAGCACGCAGGAGG + Intronic
939000470 2:136728338-136728360 AGTTCTCTGTATCACTCTGGAGG + Intergenic
939739443 2:145887370-145887392 AGACCCCTGCCTCACTGTGGTGG - Intergenic
942542737 2:177031522-177031544 TATGCTCAGCATCACAGTGGGGG - Intergenic
944174584 2:196815937-196815959 AGTCCTCATCATCACTGAGGAGG - Intergenic
944374203 2:199021872-199021894 CTGCCTGTGCATCACTGTGGTGG - Intergenic
945010210 2:205453114-205453136 TGTCAGCTGCATCTCTCTGGAGG - Intronic
945049291 2:205807828-205807850 TCTCCTCTGCATCCATGTGGTGG - Intergenic
947329399 2:229013049-229013071 ATTCCTCTGCCTCACTGTGGAGG - Intronic
948003699 2:234590171-234590193 AGCTCTCAGCATCACTGTGGGGG - Intergenic
1172542432 20:35729633-35729655 TTTCCTCTTCATAACTGAGGTGG - Intronic
1172853960 20:37986979-37987001 TGTCCTCTGCATGCCTGAGGTGG + Intronic
1175286883 20:57842525-57842547 TGTTCTCTGCACAAATGTGGTGG + Intergenic
1175330927 20:58163308-58163330 TGGCCACTGCTTGACTGTGGTGG - Intergenic
1175716316 20:61256528-61256550 TGTGCTCTTGATCAGTGTGGTGG + Intronic
1175730498 20:61350569-61350591 TGGCCTCTGCAGCACTGTGGGGG - Intronic
1175936995 20:62518492-62518514 TGTCCTCTGCCTCTGTGAGGGGG + Intergenic
1177469004 21:21531364-21531386 TGTTACCTGCATCACTGTCGTGG - Intronic
1177837755 21:26204372-26204394 TGTCCTCTGAAACAGTCTGGAGG - Intergenic
1181651604 22:24261982-24262004 TGGCCTCTGCATCACCCTTGGGG - Intergenic
1184172066 22:42765699-42765721 TGGCTCCTGCATCCCTGTGGTGG + Intergenic
1203275381 22_KI270734v1_random:82767-82789 TGGCCTCTGCATCACCCTTGGGG - Intergenic
949157592 3:847883-847905 TGTCCTCTTAACCACTGTGGTGG - Intergenic
949549379 3:5099605-5099627 TGTCCCCTCCTTCAGTGTGGTGG - Intergenic
950968376 3:17162417-17162439 TGCCCCCTACATCACTGAGGAGG - Intronic
951166513 3:19489379-19489401 TGTCCTCTTAACCACTGTGAGGG + Intronic
951525309 3:23647596-23647618 TGGCCTCAGCATCAATGTGGTGG + Intergenic
952516692 3:34111892-34111914 AATCCTCTGCCTCACTGTGTTGG + Intergenic
956622420 3:71234660-71234682 TGTCCTGTGCATAACTGGAGAGG - Intronic
957405763 3:79774162-79774184 TGTCCTCTTAACCGCTGTGGGGG - Intergenic
957954834 3:87173120-87173142 TGTCTTCTGCATAACTGTGTGGG + Intergenic
959942600 3:112095223-112095245 TGTCCTCAGCATGACGGAGGAGG - Intronic
962957499 3:140279638-140279660 TGACGTCTGCTTAACTGTGGTGG + Intronic
967921716 3:194619063-194619085 TGTCCTCTGTAACATGGTGGTGG - Intronic
968002229 3:195214011-195214033 TGTTACCTGCATCACTGGGGTGG + Intronic
968541501 4:1170672-1170694 TGCCCTCTGCACCACTGTTGGGG + Intronic
968932451 4:3588447-3588469 TATCCCCAGCAGCACTGTGGAGG + Intronic
970428337 4:15965389-15965411 TGTTCCCTGCAACACTGTGGTGG - Intronic
976771584 4:88658979-88659001 TGTCTCCTGCATCACTATAGTGG + Intronic
978821069 4:112967167-112967189 TGTCATCTGCACCATTGAGGAGG + Intronic
980072807 4:128261291-128261313 TGTTCTCTCAACCACTGTGGTGG - Intergenic
980779623 4:137479574-137479596 TGTCCTCTTAACCACTCTGGGGG - Intergenic
981270382 4:142839930-142839952 TGTCCTCAAGATCAATGTGGTGG - Intronic
982932694 4:161428891-161428913 GGTACTCTGCTCCACTGTGGCGG - Intronic
986695704 5:10353283-10353305 TGGCCTCGGCATCACGGTGCGGG + Intergenic
987943839 5:24578049-24578071 TCTCCTCACCAGCACTGTGGTGG - Intronic
988145431 5:27299854-27299876 TCTCCTCTTCACCACTGTGAAGG + Intergenic
988837082 5:35044284-35044306 TCTCCTCTGCTTCTCTGTGCTGG + Intronic
993671771 5:90769176-90769198 TGTACCCTGCATCTCAGTGGTGG - Intronic
993968925 5:94393087-94393109 TTTCCTGTCCATCACTGTGCAGG + Intronic
994272737 5:97801468-97801490 TATCCTCTGCATCACTGAGGAGG + Intergenic
995362345 5:111311550-111311572 TGTCCCCTACATGGCTGTGGAGG - Intronic
995473316 5:112525163-112525185 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1001669094 5:173459218-173459240 TGTCAGCAGCATCTCTGTGGGGG + Intergenic
1003752545 6:9075978-9076000 TGTCCTCTCCATTACTTTGTTGG + Intergenic
1004695931 6:18033035-18033057 TCTCCTCTGCAGAACTCTGGAGG + Intergenic
1007823569 6:44580188-44580210 TCTCCTGTGCATTACTATGGGGG + Intergenic
1008123263 6:47641668-47641690 TGTTCTCTCAACCACTGTGGGGG - Intergenic
1009525083 6:64733447-64733469 TGTCAGCAGCATCATTGTGGTGG - Intronic
1014018440 6:116561877-116561899 TGCACTCTGCAGCACTGTGCTGG + Intergenic
1014114298 6:117655037-117655059 TGTCCACTGCATAACCCTGGGGG - Intergenic
1014264258 6:119257145-119257167 TGTGCTCTGGATTAATGTGGAGG + Intronic
1014547272 6:122747968-122747990 TGTCCTCTTAACCACTGTGGGGG + Intergenic
1018754536 6:166837646-166837668 TGTCCTCATCACCTCTGTGGGGG + Intronic
1019192695 6:170262415-170262437 TGTCTGCTGCTTCACTCTGGGGG - Intergenic
1019314239 7:377208-377230 TGTCCTCTGCCACACTCAGGGGG - Intergenic
1023925440 7:44665968-44665990 TATTCGCTGCAGCACTGTGGGGG - Intronic
1024555979 7:50604072-50604094 TGTCCTGTGAATCACTGTGGGGG + Exonic
1024881892 7:54096238-54096260 ACTGCTGTGCATCACTGTGGAGG + Intergenic
1026782400 7:73277736-73277758 TATCCTTTGCAGCAATGTGGAGG + Intergenic
1027023162 7:74830557-74830579 TATCCTTTGCAGCAATGTGGAGG + Intronic
1027064766 7:75114739-75114761 TATCCTTTGCAGCAATGTGGAGG - Intronic
1028809555 7:95068701-95068723 TGCTCTCAGCATCCCTGTGGTGG + Intronic
1031669459 7:124525112-124525134 TAGCCACTGCATCAGTGTGGTGG + Intergenic
1032170430 7:129579680-129579702 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1033436611 7:141338715-141338737 TGGCCTATGCAGCAGTGTGGTGG + Intronic
1034361509 7:150503493-150503515 TGTTCTCTGCACCACTTTGTAGG + Intergenic
1036481815 8:9146905-9146927 TGTCCTTTGCAAAACTGTGCTGG + Intronic
1037833666 8:22203728-22203750 TGTCCACTGGTTCACTGTTGAGG - Intronic
1038318134 8:26504824-26504846 TAACCACTGCATCACTTTGGTGG + Exonic
1039498630 8:38000001-38000023 TGTCCTCTACTCCACTGTGCTGG + Intergenic
1039877041 8:41595895-41595917 TGTTCTCTCAACCACTGTGGCGG + Intronic
1039908547 8:41805813-41805835 TGCCATCTACATCAATGTGGTGG + Intronic
1040622095 8:49102454-49102476 GGTCCTCTTCCACACTGTGGAGG - Intergenic
1041438477 8:57867696-57867718 TTTCATCTGCTTCACTGTAGAGG - Intergenic
1043840584 8:85099016-85099038 TGTCCTTTGCAGCAAAGTGGAGG - Intergenic
1044879224 8:96705641-96705663 TGTCTACTTCATCACTTTGGAGG + Intronic
1046606990 8:116382374-116382396 TGGCCTCAGCATGAATGTGGTGG - Intergenic
1047296104 8:123571849-123571871 TGTCCTCTGCACAACTGAAGGGG - Intergenic
1048018845 8:130520120-130520142 AGTCCTCTGCATGCCTGGGGTGG + Intergenic
1048018866 8:130520174-130520196 AGTCCTCTGCATGCCTGGGGTGG + Intergenic
1049087489 8:140489953-140489975 GGTCCTCTTCCACACTGTGGAGG - Intergenic
1049712631 8:144072699-144072721 TGTCATTTGCATCACCCTGGAGG - Intergenic
1051027651 9:12632734-12632756 TGTCCTCTTCATTAGAGTGGAGG + Intergenic
1052129796 9:24829260-24829282 TGTCATTTGCAGCACTTTGGAGG + Intergenic
1052336814 9:27328784-27328806 TGTTCTCTGGATCTCTGTGATGG + Exonic
1052464520 9:28813636-28813658 TGTCCTCAGAATCACTGTGAGGG - Intergenic
1052568659 9:30191337-30191359 GGGCATCTGCATCACTGAGGTGG - Intergenic
1053688466 9:40567132-40567154 TGTGTTCTGCTTCAGTGTGGAGG - Intergenic
1054275564 9:63063926-63063948 TGTGCTCTGCTTCAGTGTGGAGG + Intergenic
1054299707 9:63368043-63368065 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
1054399269 9:64701005-64701027 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
1054432848 9:65185270-65185292 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
1054457675 9:65443449-65443471 TATCCCCAGCAGCACTGTGGAGG - Intergenic
1054497537 9:65836405-65836427 TGTGCTCTGCTTCAGTGTGGAGG + Intergenic
1055621716 9:78132786-78132808 TGTCTTCTATATCACTGTGTAGG - Intergenic
1056809766 9:89755084-89755106 TGTCTTGTGCTTCACTGAGGAGG - Intergenic
1058228782 9:102399755-102399777 TGTTCTCTGCATGACTTTGTAGG - Intergenic
1058252623 9:102719461-102719483 TGTCCTTTACATCAATATGGAGG + Intergenic
1060047007 9:120349236-120349258 TGTCCTCTGTCTGACTTTGGCGG - Intergenic
1060529651 9:124340737-124340759 TGTCCTGAGCATCACTGCTGTGG - Intronic
1060986133 9:127819977-127819999 TGTCCTCTGCCTCACAGCTGGGG + Exonic
1061300422 9:129701515-129701537 TGTCCACTGCATAACTGCAGGGG + Intronic
1061321655 9:129834881-129834903 CGTCCTCTGGACCACTGTGCTGG - Intronic
1061681577 9:132245096-132245118 TGCCCTCTGCACCACCGTGTGGG - Intergenic
1062027442 9:134347043-134347065 TGGCCTTTCCATCACTGTGGAGG + Intronic
1185909437 X:3968690-3968712 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1186136819 X:6530020-6530042 TGTCCTGTGTATCACTGACGTGG + Intergenic
1186376679 X:9010800-9010822 TGTCCTGTGTATCACTGACGTGG - Intergenic
1186462249 X:9757620-9757642 TCCCCTCTACATCTCTGTGGTGG - Intronic
1190315455 X:49147684-49147706 TGTCCTCTTAACCACTGTAGGGG + Intergenic
1190426368 X:50337420-50337442 TGTCCTCTTAACCACTGTGGGGG + Intronic
1191036532 X:56030891-56030913 TGTCCTGTTAACCACTGTGGGGG + Intergenic
1196072499 X:111542004-111542026 TTTCCTTTGCATGACTTTGGTGG + Intergenic
1196240162 X:113334402-113334424 TGACATCTGCCTAACTGTGGAGG + Intergenic
1200394611 X:155976398-155976420 TGTCCTCTTAACCACTGTCGGGG + Intergenic
1200932964 Y:8713961-8713983 TGTCCTCTTAACCACTGTGAGGG - Intergenic
1200942916 Y:8804277-8804299 TGTCCTCTTAACTACTGTGGGGG - Intergenic
1200984068 Y:9287804-9287826 TGTCCTCTTCACCACTGTGCAGG + Intergenic
1201220777 Y:11767845-11767867 GGTTCTCTGCATGACTGTGTGGG - Intergenic
1201270195 Y:12246769-12246791 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1202126380 Y:21572438-21572460 TGTCCTCTTAACCACTGTGCAGG - Intergenic
1202152619 Y:21856966-21856988 TATCCTCTTAATCACTGTGCAGG + Intergenic