ID: 1097733095

View in Genome Browser
Species Human (GRCh38)
Location 12:63151367-63151389
Sequence TGGACGAGTCATGCCTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097733088_1097733095 8 Left 1097733088 12:63151336-63151358 CCCGCTTTTCCCTTCCAAAAACT 0: 1
1: 1
2: 1
3: 35
4: 403
Right 1097733095 12:63151367-63151389 TGGACGAGTCATGCCTTTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 74
1097733089_1097733095 7 Left 1097733089 12:63151337-63151359 CCGCTTTTCCCTTCCAAAAACTT 0: 1
1: 0
2: 3
3: 65
4: 584
Right 1097733095 12:63151367-63151389 TGGACGAGTCATGCCTTTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 74
1097733091_1097733095 -1 Left 1097733091 12:63151345-63151367 CCCTTCCAAAAACTTGGACAACT 0: 1
1: 0
2: 1
3: 6
4: 205
Right 1097733095 12:63151367-63151389 TGGACGAGTCATGCCTTTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 74
1097733094_1097733095 -6 Left 1097733094 12:63151350-63151372 CCAAAAACTTGGACAACTGGACG 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1097733095 12:63151367-63151389 TGGACGAGTCATGCCTTTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 74
1097733092_1097733095 -2 Left 1097733092 12:63151346-63151368 CCTTCCAAAAACTTGGACAACTG 0: 1
1: 0
2: 1
3: 21
4: 168
Right 1097733095 12:63151367-63151389 TGGACGAGTCATGCCTTTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097733095 Original CRISPR TGGACGAGTCATGCCTTTTC TGG Intergenic
901403558 1:9031442-9031464 GGGACTTGTGATGCCTTTTCTGG - Intergenic
902093411 1:13922672-13922694 TTGATGAGTCATGCTTTCTCAGG - Intergenic
915699829 1:157781288-157781310 TGGATGGGTTATGACTTTTCAGG + Intergenic
1070513277 10:77180175-77180197 TGGAAGGGTGCTGCCTTTTCTGG - Intronic
1070605922 10:77898540-77898562 AGGAGGAGGCAGGCCTTTTCTGG - Intronic
1073931238 10:108579148-108579170 TTGAGTTGTCATGCCTTTTCTGG - Intergenic
1075662373 10:124206992-124207014 TGGAAGAGTCTGGCCTTCTCTGG - Intergenic
1078175222 11:8964813-8964835 TGGCCGAGCCATGCCTTTCCGGG + Intronic
1080639110 11:34148528-34148550 TGGGGGAGACATGCCTTTTCAGG - Intergenic
1081619430 11:44610436-44610458 TGTAAGAGTCATGCTTTTTTAGG - Intronic
1084564268 11:69920492-69920514 TGGGTGAGTCCTCCCTTTTCAGG + Intergenic
1086094486 11:83036828-83036850 TGGACACGCCAAGCCTTTTCTGG - Intronic
1091866253 12:3839423-3839445 AGGACGGGTCGTGCCTGTTCCGG + Intronic
1097733095 12:63151367-63151389 TGGACGAGTCATGCCTTTTCTGG + Intergenic
1098015918 12:66104486-66104508 TGGAGGCCTCTTGCCTTTTCTGG - Intergenic
1099533249 12:83813767-83813789 TGGACTAGTGATGACTTTTAAGG - Intergenic
1099775052 12:87115667-87115689 TGCAAGAAGCATGCCTTTTCTGG + Intergenic
1099782947 12:87223108-87223130 TGACCCAGTCATGCCTCTTCTGG - Intergenic
1106206400 13:27600058-27600080 TGAATGAGTCATGAATTTTCTGG - Intronic
1109511531 13:63381357-63381379 TGAAAGAGTCATGAATTTTCAGG - Intergenic
1124015981 15:25876259-25876281 TGGAGGACTCAGGCCTTTTTCGG - Intergenic
1124242785 15:28044559-28044581 TGAACAAGTCATGGCTTTACAGG + Intronic
1125965667 15:43873867-43873889 GGGAGGAGTCATGCCTTCTCAGG + Exonic
1126688611 15:51269699-51269721 TGGAAGAGTCCTGCCTTGGCTGG - Intronic
1126941365 15:53769594-53769616 TGGACTATTCATGAGTTTTCTGG + Intergenic
1130861545 15:87895170-87895192 TGGACAAGTCATTGCTTTTCTGG - Intronic
1143717471 17:8785231-8785253 TGGAAGTGTCATCTCTTTTCTGG + Intergenic
1150532681 17:66001010-66001032 TTGACGTGTCATGCCTTATGTGG - Intronic
1151730159 17:75906272-75906294 TGGAAAAGTCTTGCCTTTTAGGG - Intronic
1156383723 18:36587125-36587147 AGGAATAGTCATGTCTTTTCTGG + Intronic
1162890868 19:13732191-13732213 GGGGCGAGTCATAACTTTTCTGG - Exonic
925736083 2:6965218-6965240 GGGACGAGGCAAGGCTTTTCTGG + Intronic
930970569 2:57390234-57390256 AGGAATAGTCATGTCTTTTCCGG + Intergenic
941185186 2:162313937-162313959 TGGACTAGTCATGGCATCTCTGG + Intronic
948303544 2:236928803-236928825 AGGAATATTCATGCCTTTTCTGG - Intergenic
1169057518 20:2635661-2635683 TGGAGGAATCATCCCTCTTCTGG - Intronic
1170937602 20:20823572-20823594 TGGCTGTGTCAAGCCTTTTCTGG + Intergenic
1173109797 20:40176007-40176029 TGGAAGAGTAATTCCTTTTTAGG + Intergenic
1175057076 20:56208381-56208403 TGGACTATTCATGAGTTTTCTGG - Intergenic
1177538585 21:22462443-22462465 TGGTCAAGTCATGACTTTTTGGG + Intergenic
1182173218 22:28254851-28254873 TGGAGGAGGCAGGCCTTTCCAGG - Intronic
1182447086 22:30396157-30396179 TGGGCAAGCCATGCCTTATCTGG + Intronic
951795788 3:26537049-26537071 TAGACGAGTTATGCGTTTTGGGG - Intergenic
957648993 3:82975094-82975116 TGGAATAAACATGCCTTTTCTGG - Intergenic
967747924 3:193080927-193080949 TCTACCAGTCATGCCTTTTGAGG - Intergenic
970374145 4:15439593-15439615 TGGGCGAGTCATTTCTTTTCTGG - Intronic
970583305 4:17492681-17492703 TGGAGGAGACATGACATTTCAGG + Intronic
973156852 4:46965753-46965775 TGTATAATTCATGCCTTTTCTGG - Intronic
975481758 4:74888869-74888891 TGGTCAAGTCAGGGCTTTTCAGG - Intergenic
977500899 4:97835334-97835356 TGGATTATTCATGCGTTTTCTGG - Intronic
979155917 4:117391126-117391148 TGGATGAATCAAGCTTTTTCAGG - Intergenic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
981475025 4:145179830-145179852 AGGACGGGTCGTGCCTGTTCCGG - Intronic
982479174 4:155888064-155888086 TGGATTATTCATGCATTTTCTGG + Intronic
983651459 4:170040539-170040561 TGGACTTGTGGTGCCTTTTCTGG + Intergenic
984615909 4:181897063-181897085 TGGAGGAATCGAGCCTTTTCAGG - Intergenic
987373242 5:17212327-17212349 TGGATTATTCATGACTTTTCTGG + Intronic
987859936 5:23471782-23471804 TGAACCAGTAATCCCTTTTCTGG - Intergenic
993348655 5:86819372-86819394 TGGACATGTAATGCCTTTGCTGG + Intergenic
996204737 5:120718674-120718696 TGGATGAGTGATGGCTTTCCTGG - Intergenic
1000192344 5:158923689-158923711 TGGACAAGCCACGCCTCTTCTGG + Intronic
1012872105 6:104684720-104684742 TGGAGTAGTCATGTCTTTTCTGG + Intergenic
1013773703 6:113654979-113655001 TGGCCTAGTTATTCCTTTTCTGG + Intergenic
1014162752 6:118188831-118188853 TGACCGAGAAATGCCTTTTCTGG - Intronic
1014423636 6:121274543-121274565 TTGAAGATTCATGCCTTTTAGGG - Intronic
1014813878 6:125914079-125914101 TGGCCCAGTAATCCCTTTTCTGG + Intronic
1014859718 6:126450670-126450692 TGGAAAATTCATGCCTTTACAGG - Intergenic
1018649933 6:165985259-165985281 TGAACTAGTCAGGCTTTTTCTGG - Intronic
1023548673 7:41345514-41345536 TGGGCGAGTGCTGCATTTTCAGG + Intergenic
1028731612 7:94157664-94157686 TGGATGATTCATGAGTTTTCTGG + Intergenic
1033260531 7:139840318-139840340 TGGAGGCGGGATGCCTTTTCCGG - Intronic
1036048426 8:5169106-5169128 TGGTCGAGTCAGGGCTTTTAGGG + Intergenic
1037012062 8:13855859-13855881 TGGATTACTCATGACTTTTCTGG - Intergenic
1055248272 9:74273342-74273364 TGGACCCCTCCTGCCTTTTCAGG + Intergenic
1056150097 9:83777441-83777463 TCAACAAATCATGCCTTTTCAGG - Intronic
1190094268 X:47466497-47466519 TGGGCGAGTCATGTGTCTTCTGG + Intronic
1190681744 X:52831709-52831731 TGGACTTGTGGTGCCTTTTCTGG + Intergenic
1194380285 X:93181845-93181867 TGGACTTGTGATGCCTATTCTGG + Intergenic
1197325005 X:125082068-125082090 TGGTCAAGTCATGGCTTTTAGGG - Intergenic
1197464491 X:126785897-126785919 TGGACTATTCATGAGTTTTCTGG + Intergenic
1199716236 X:150508979-150509001 AGAGCAAGTCATGCCTTTTCTGG + Intronic