ID: 1097735647

View in Genome Browser
Species Human (GRCh38)
Location 12:63178274-63178296
Sequence CTGCTCCAGTTGACAACATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097735639_1097735647 24 Left 1097735639 12:63178227-63178249 CCAAATATGTGAGTGAAGAAGCC No data
Right 1097735647 12:63178274-63178296 CTGCTCCAGTTGACAACATGGGG No data
1097735642_1097735647 3 Left 1097735642 12:63178248-63178270 CCATCTTCTATATTGGGATCCTC No data
Right 1097735647 12:63178274-63178296 CTGCTCCAGTTGACAACATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097735647 Original CRISPR CTGCTCCAGTTGACAACATG GGG Intergenic
No off target data available for this crispr