ID: 1097735977

View in Genome Browser
Species Human (GRCh38)
Location 12:63180984-63181006
Sequence TCATCCCCACATAAAGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097735975_1097735977 2 Left 1097735975 12:63180959-63180981 CCTCTCTAAAATGATTCCAGCTG No data
Right 1097735977 12:63180984-63181006 TCATCCCCACATAAAGAGCATGG No data
1097735974_1097735977 3 Left 1097735974 12:63180958-63180980 CCCTCTCTAAAATGATTCCAGCT No data
Right 1097735977 12:63180984-63181006 TCATCCCCACATAAAGAGCATGG No data
1097735973_1097735977 21 Left 1097735973 12:63180940-63180962 CCATTAGTCTCAACACTTCCCTC No data
Right 1097735977 12:63180984-63181006 TCATCCCCACATAAAGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097735977 Original CRISPR TCATCCCCACATAAAGAGCA TGG Intergenic
No off target data available for this crispr