ID: 1097739004

View in Genome Browser
Species Human (GRCh38)
Location 12:63216532-63216554
Sequence GTCCTTAGGAAACCTGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097739000_1097739004 13 Left 1097739000 12:63216496-63216518 CCTCTGGTCCAAAAAACAGAAAT No data
Right 1097739004 12:63216532-63216554 GTCCTTAGGAAACCTGAATCAGG No data
1097738998_1097739004 27 Left 1097738998 12:63216482-63216504 CCTCACCATTGGTTCCTCTGGTC No data
Right 1097739004 12:63216532-63216554 GTCCTTAGGAAACCTGAATCAGG No data
1097738999_1097739004 22 Left 1097738999 12:63216487-63216509 CCATTGGTTCCTCTGGTCCAAAA No data
Right 1097739004 12:63216532-63216554 GTCCTTAGGAAACCTGAATCAGG No data
1097739001_1097739004 5 Left 1097739001 12:63216504-63216526 CCAAAAAACAGAAATTGATTTTA No data
Right 1097739004 12:63216532-63216554 GTCCTTAGGAAACCTGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097739004 Original CRISPR GTCCTTAGGAAACCTGAATC AGG Intergenic
No off target data available for this crispr