ID: 1097743958

View in Genome Browser
Species Human (GRCh38)
Location 12:63278629-63278651
Sequence CCTCATTTGGAGACAGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097743952_1097743958 8 Left 1097743952 12:63278598-63278620 CCCATATTATCCTACTGGTTGCA No data
Right 1097743958 12:63278629-63278651 CCTCATTTGGAGACAGTGAAAGG No data
1097743953_1097743958 7 Left 1097743953 12:63278599-63278621 CCATATTATCCTACTGGTTGCAA No data
Right 1097743958 12:63278629-63278651 CCTCATTTGGAGACAGTGAAAGG No data
1097743950_1097743958 23 Left 1097743950 12:63278583-63278605 CCTCACATTATAATTCCCATATT No data
Right 1097743958 12:63278629-63278651 CCTCATTTGGAGACAGTGAAAGG No data
1097743955_1097743958 -2 Left 1097743955 12:63278608-63278630 CCTACTGGTTGCAAAGGTCAGCC No data
Right 1097743958 12:63278629-63278651 CCTCATTTGGAGACAGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097743958 Original CRISPR CCTCATTTGGAGACAGTGAA AGG Intergenic
No off target data available for this crispr