ID: 1097744403

View in Genome Browser
Species Human (GRCh38)
Location 12:63285493-63285515
Sequence GTTTTGGGGTGCATCTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097744399_1097744403 -1 Left 1097744399 12:63285471-63285493 CCTGAAGAACTGGTAAAACATTG No data
Right 1097744403 12:63285493-63285515 GTTTTGGGGTGCATCTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097744403 Original CRISPR GTTTTGGGGTGCATCTGTGC AGG Intergenic
No off target data available for this crispr