ID: 1097754592

View in Genome Browser
Species Human (GRCh38)
Location 12:63395601-63395623
Sequence GATGCTCTTGGAATTCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097754592_1097754594 -3 Left 1097754592 12:63395601-63395623 CCAGTCTGAATTCCAAGAGCATC No data
Right 1097754594 12:63395621-63395643 ATCTTATCTCTAAACACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097754592 Original CRISPR GATGCTCTTGGAATTCAGAC TGG (reversed) Intergenic
No off target data available for this crispr