ID: 1097760245

View in Genome Browser
Species Human (GRCh38)
Location 12:63456670-63456692
Sequence TCAAGTTCTGGCTTTGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097760245_1097760254 15 Left 1097760245 12:63456670-63456692 CCTGAGGCAAAGCCAGAACTTGA No data
Right 1097760254 12:63456708-63456730 ACAAGGACCCAGAAGGAGAGGGG No data
1097760245_1097760249 -2 Left 1097760245 12:63456670-63456692 CCTGAGGCAAAGCCAGAACTTGA No data
Right 1097760249 12:63456691-63456713 GAGGGTCATCTTCAACCACAAGG No data
1097760245_1097760252 13 Left 1097760245 12:63456670-63456692 CCTGAGGCAAAGCCAGAACTTGA No data
Right 1097760252 12:63456706-63456728 CCACAAGGACCCAGAAGGAGAGG No data
1097760245_1097760250 8 Left 1097760245 12:63456670-63456692 CCTGAGGCAAAGCCAGAACTTGA No data
Right 1097760250 12:63456701-63456723 TTCAACCACAAGGACCCAGAAGG No data
1097760245_1097760253 14 Left 1097760245 12:63456670-63456692 CCTGAGGCAAAGCCAGAACTTGA No data
Right 1097760253 12:63456707-63456729 CACAAGGACCCAGAAGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097760245 Original CRISPR TCAAGTTCTGGCTTTGCCTC AGG (reversed) Intergenic