ID: 1097760248

View in Genome Browser
Species Human (GRCh38)
Location 12:63456682-63456704
Sequence TGAAGATGACCCTCAAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097760248_1097760253 2 Left 1097760248 12:63456682-63456704 CCAGAACTTGAGGGTCATCTTCA No data
Right 1097760253 12:63456707-63456729 CACAAGGACCCAGAAGGAGAGGG No data
1097760248_1097760250 -4 Left 1097760248 12:63456682-63456704 CCAGAACTTGAGGGTCATCTTCA No data
Right 1097760250 12:63456701-63456723 TTCAACCACAAGGACCCAGAAGG No data
1097760248_1097760254 3 Left 1097760248 12:63456682-63456704 CCAGAACTTGAGGGTCATCTTCA No data
Right 1097760254 12:63456708-63456730 ACAAGGACCCAGAAGGAGAGGGG No data
1097760248_1097760252 1 Left 1097760248 12:63456682-63456704 CCAGAACTTGAGGGTCATCTTCA No data
Right 1097760252 12:63456706-63456728 CCACAAGGACCCAGAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097760248 Original CRISPR TGAAGATGACCCTCAAGTTC TGG (reversed) Intergenic