ID: 1097760254

View in Genome Browser
Species Human (GRCh38)
Location 12:63456708-63456730
Sequence ACAAGGACCCAGAAGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097760248_1097760254 3 Left 1097760248 12:63456682-63456704 CCAGAACTTGAGGGTCATCTTCA No data
Right 1097760254 12:63456708-63456730 ACAAGGACCCAGAAGGAGAGGGG No data
1097760245_1097760254 15 Left 1097760245 12:63456670-63456692 CCTGAGGCAAAGCCAGAACTTGA No data
Right 1097760254 12:63456708-63456730 ACAAGGACCCAGAAGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097760254 Original CRISPR ACAAGGACCCAGAAGGAGAG GGG Intergenic
No off target data available for this crispr