ID: 1097761256

View in Genome Browser
Species Human (GRCh38)
Location 12:63467514-63467536
Sequence TTTACTTACAGGGGCTGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097761256_1097761262 25 Left 1097761256 12:63467514-63467536 CCAGAGCAGCCCCTGTAAGTAAA No data
Right 1097761262 12:63467562-63467584 TTACCAAAGAAAACCTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097761256 Original CRISPR TTTACTTACAGGGGCTGCTC TGG (reversed) Intergenic
No off target data available for this crispr