ID: 1097767212

View in Genome Browser
Species Human (GRCh38)
Location 12:63539710-63539732
Sequence GCTAGGACATTGGTCTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097767212_1097767214 -9 Left 1097767212 12:63539710-63539732 CCAGAAAAGACCAATGTCCTAGC No data
Right 1097767214 12:63539724-63539746 TGTCCTAGCTCAAAGCAGTCAGG No data
1097767212_1097767218 17 Left 1097767212 12:63539710-63539732 CCAGAAAAGACCAATGTCCTAGC No data
Right 1097767218 12:63539750-63539772 GAGTAGTTCCCTCATATTTGAGG No data
1097767212_1097767215 -8 Left 1097767212 12:63539710-63539732 CCAGAAAAGACCAATGTCCTAGC No data
Right 1097767215 12:63539725-63539747 GTCCTAGCTCAAAGCAGTCAGGG No data
1097767212_1097767217 -5 Left 1097767212 12:63539710-63539732 CCAGAAAAGACCAATGTCCTAGC No data
Right 1097767217 12:63539728-63539750 CTAGCTCAAAGCAGTCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097767212 Original CRISPR GCTAGGACATTGGTCTTTTC TGG (reversed) Intergenic
No off target data available for this crispr