ID: 1097767497

View in Genome Browser
Species Human (GRCh38)
Location 12:63542797-63542819
Sequence TGCCCACTCAGACCCCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097767491_1097767497 26 Left 1097767491 12:63542748-63542770 CCTAAGAGTCTCTCCCAGGTGCT No data
Right 1097767497 12:63542797-63542819 TGCCCACTCAGACCCCAAAGTGG No data
1097767494_1097767497 12 Left 1097767494 12:63542762-63542784 CCAGGTGCTCACAGGCAGAGAAC No data
Right 1097767497 12:63542797-63542819 TGCCCACTCAGACCCCAAAGTGG No data
1097767493_1097767497 13 Left 1097767493 12:63542761-63542783 CCCAGGTGCTCACAGGCAGAGAA No data
Right 1097767497 12:63542797-63542819 TGCCCACTCAGACCCCAAAGTGG No data
1097767490_1097767497 27 Left 1097767490 12:63542747-63542769 CCCTAAGAGTCTCTCCCAGGTGC No data
Right 1097767497 12:63542797-63542819 TGCCCACTCAGACCCCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097767497 Original CRISPR TGCCCACTCAGACCCCAAAG TGG Intergenic
No off target data available for this crispr