ID: 1097767975

View in Genome Browser
Species Human (GRCh38)
Location 12:63547418-63547440
Sequence ATGGATGAGCAAGACCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097767975_1097767982 7 Left 1097767975 12:63547418-63547440 CCAAGATGGTCTTGCTCATCCAT No data
Right 1097767982 12:63547448-63547470 TTTGGTGCTGGCTGTCAACCTGG No data
1097767975_1097767980 -5 Left 1097767975 12:63547418-63547440 CCAAGATGGTCTTGCTCATCCAT No data
Right 1097767980 12:63547436-63547458 TCCATCTGGGGCTTTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097767975 Original CRISPR ATGGATGAGCAAGACCATCT TGG (reversed) Intergenic
No off target data available for this crispr