ID: 1097772679

View in Genome Browser
Species Human (GRCh38)
Location 12:63606960-63606982
Sequence TATTACACACAACCTGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 4, 1: 1, 2: 0, 3: 9, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097772679 Original CRISPR TATTACACACAACCTGAACA AGG (reversed) Intronic
900833984 1:4985847-4985869 TGTTACATAGAACCTGGACAGGG + Intergenic
905989375 1:42320502-42320524 TTTTACAGAAAACCTGAAAAAGG + Intronic
909700437 1:78515281-78515303 TATACCACCCAACCTGAAGAGGG + Intronic
911894545 1:103414914-103414936 CATTTCCCACAAACTGAACAAGG + Intergenic
915861348 1:159448134-159448156 TATTACATTCAACATGACCAAGG + Intergenic
917730036 1:177866008-177866030 AATTACACACAACATAATCATGG + Intergenic
923498362 1:234544155-234544177 TATTACATACAATCTGTACAGGG + Intergenic
1063623774 10:7670873-7670895 TATTACACACAACTAGCACAGGG - Intergenic
1064274931 10:13897167-13897189 TATTAAACTCAAGCTGAAAATGG - Intronic
1065680676 10:28228425-28228447 TAGTGCAAACAACTTGAACATGG + Intronic
1072795451 10:98351381-98351403 TATCACACAAAATCTGAACCAGG - Intergenic
1073762649 10:106646945-106646967 TATCATAAACAAGCTGAACAAGG - Intronic
1076278729 10:129226921-129226943 AAACACACACAACCTGTACATGG - Intergenic
1083970796 11:66073282-66073304 TATTCTAAACAACATGAACAAGG - Intronic
1085750437 11:79156360-79156382 CGTTACACACAACGTGAACAGGG - Intronic
1087092156 11:94284668-94284690 TCATAAACACAACCTGTACAGGG - Intergenic
1087965417 11:104406910-104406932 TATTACTCACAGTCTCAACAAGG + Intergenic
1087974538 11:104528580-104528602 TGTGACACACAACATCAACATGG - Intergenic
1092801165 12:12168645-12168667 TCTTTAACACAAGCTGAACAGGG - Intronic
1097483692 12:60165703-60165725 TATTACACACAAAATCAGCAAGG + Intergenic
1097772679 12:63606960-63606982 TATTACACACAACCTGAACAAGG - Intronic
1100318682 12:93469118-93469140 TATTAAACACCACAAGAACAAGG - Intronic
1102735118 12:115152241-115152263 AGTTACACACAGCCTGCACATGG - Intergenic
1105518613 13:21112130-21112152 TAATACACTTAACCTAAACAAGG + Intergenic
1108751683 13:53453813-53453835 AATGAAACAAAACCTGAACAAGG + Intergenic
1111021028 13:82452613-82452635 TATGTTACACCACCTGAACATGG - Intergenic
1112312654 13:98333173-98333195 TATCACACAAAAACTGAACAAGG - Intronic
1112609777 13:100945136-100945158 TCTTTCACACAAACTGAACAAGG + Intergenic
1114732242 14:25005608-25005630 GCTTACACACAAACTCAACATGG + Intronic
1121741855 14:96258428-96258450 TATCACTCAGAACCTGCACAGGG - Intronic
1123842847 15:24266878-24266900 TAATACACACAACATGAAAAGGG - Intergenic
1123857885 15:24432905-24432927 TAATACACACAACATAAAAAGGG - Intergenic
1125104670 15:35956580-35956602 TTTTGCACACATCCTGAACTAGG - Intergenic
1126741055 15:51776369-51776391 TATTACACAGAACTTGCACCAGG - Intronic
1127276125 15:57445692-57445714 TATCACACACAACTTGCACCTGG + Intronic
1127629068 15:60809224-60809246 TATTCCACACATCCTAAAAATGG + Intronic
1130710508 15:86276407-86276429 TATTACACACATTCTACACATGG - Intronic
1152877666 17:82796352-82796374 TATTTCACACAAACTAAAGATGG + Intronic
1153278226 18:3390058-3390080 TAGTATACACAACCAAAACAAGG - Intergenic
1155205647 18:23555753-23555775 TATCACTCACTGCCTGAACATGG - Intronic
1158780016 18:60637273-60637295 TATTGCACACCAACTGAAAAAGG - Intergenic
929280976 2:40078228-40078250 TAATACACAAGACCTGAGCAAGG + Intergenic
929325042 2:40599684-40599706 TATTAAACACAACCTAATTACGG + Intronic
932882991 2:75521491-75521513 TATTACGCACAGCCTTAAAAAGG + Intronic
940551487 2:155163085-155163107 TATTACAAACAGCCTGAGCTTGG - Intergenic
1169079876 20:2791019-2791041 TATTTTACACAATGTGAACATGG + Intergenic
1173117210 20:40256198-40256220 TGTTACATATAACCTGAGCACGG + Intergenic
1178699786 21:34823363-34823385 TCTTCCACACAATCTGAACTGGG - Intronic
1181660810 22:24347166-24347188 TATTACACGTACCTTGAACAGGG - Exonic
1182133023 22:27872416-27872438 TATTACAAAGAACCTGAGAATGG - Intronic
1183238252 22:36636431-36636453 GCATACACACAACCTGGACAGGG + Intronic
1184899165 22:47433508-47433530 TACTACACAACACCTGCACACGG + Intergenic
950929204 3:16772208-16772230 TTTTACACACACCTTGTACAAGG + Intergenic
955019907 3:55109910-55109932 GATGACACAGAACCTGAAGATGG - Intergenic
955621319 3:60867234-60867256 TGTTACACACTAACTGAATATGG + Intronic
955648671 3:61168774-61168796 TCTTACAAACAACCTGATCTGGG + Intronic
957853079 3:85836420-85836442 TTTTAGAAACAACCTGATCAAGG + Intronic
962108701 3:132419021-132419043 CATTACACAAAATGTGAACAAGG - Intronic
964708271 3:159644438-159644460 AATTACAGATAACCTGGACAGGG - Intronic
965871038 3:173265583-173265605 TATTACGCACAGCATGAACAAGG - Intergenic
968199240 3:196738320-196738342 TTTCACACTCAACCTGAAGAAGG - Intergenic
969939011 4:10711931-10711953 TATTCAACAGAACCTGAACATGG + Intergenic
975429549 4:74272589-74272611 CATTAAACACTCCCTGAACAGGG - Intronic
977182405 4:93893116-93893138 TATTATACACAGCATGACCAAGG + Intergenic
987170936 5:15257252-15257274 TATTACAGACAAAATGAAAAGGG - Intergenic
988084232 5:26453731-26453753 TATTACACAGTACCAGAAAATGG + Intergenic
989463651 5:41729282-41729304 TGTTACACAAAAAGTGAACAAGG + Intergenic
991214459 5:64146563-64146585 TATCACTTGCAACCTGAACATGG - Intergenic
991518420 5:67466222-67466244 TATAACCCATAACCTGAGCAGGG - Intergenic
991898188 5:71427801-71427823 TTTTACTCACAACTTGAACCTGG - Intergenic
1004052036 6:12092954-12092976 CATCACACCCTACCTGAACAAGG - Intronic
1006108640 6:31730991-31731013 TCTTACACACCACCTGAGGATGG + Exonic
1006681722 6:35801952-35801974 TATTAAAAACAACCTGAGCCAGG + Intergenic
1007139720 6:39559327-39559349 TAATTCACACCACCTGAAGAGGG - Intronic
1012775132 6:103487586-103487608 TATTACACCCAACATCACCAGGG + Intergenic
1013663937 6:112327276-112327298 CATTCCACACAACCTGACCTTGG - Intergenic
1014807330 6:125844909-125844931 TATTAAACACAACCTGTGCCTGG - Intronic
1017675685 6:156811380-156811402 TATAACACACAACCTGTAGTTGG - Intronic
1017841856 6:158228731-158228753 TAATACCTCCAACCTGAACATGG - Intergenic
1021628762 7:22623031-22623053 TATAACACACCAACTGAATAAGG - Intronic
1021642179 7:22748955-22748977 TATTATAAAGACCCTGAACAGGG + Intergenic
1022365549 7:29711709-29711731 TATTACACACAACCTGAACAAGG + Intergenic
1022696027 7:32706780-32706802 TATTACACACAACCTGCACAAGG - Intergenic
1022932241 7:35130654-35130676 TATTACACACAACCTGAACAAGG - Intergenic
1025781926 7:64609468-64609490 TCTCACCCACAAGCTGAACAAGG - Intergenic
1027864981 7:83633892-83633914 TATTACACACACCATTCACAGGG + Intronic
1029046034 7:97629882-97629904 AAGTACACACAAGCTGAAGATGG + Intergenic
1029828173 7:103223453-103223475 TATTACACACAACCTGAACAAGG - Intergenic
1032490037 7:132317722-132317744 TGTTGCACACAACCTGGTCATGG - Intronic
1038765187 8:30421642-30421664 TATTACACACAAGGTTAAAAAGG + Intronic
1043282609 8:78486868-78486890 TAATAAACACAAACTGAATAAGG + Intergenic
1045927144 8:107587070-107587092 TATTACACCCAACATCACCAGGG - Intergenic
1047143576 8:122170770-122170792 TATTCCACAAATCCTAAACAGGG - Intergenic
1050463156 9:5894246-5894268 GTGTACCCACAACCTGAACAAGG + Intronic
1056758269 9:89396404-89396426 AAGTACAGACAGCCTGAACATGG - Intronic
1056871705 9:90287886-90287908 TATGACACACGAGGTGAACAGGG - Intergenic
1058117206 9:101098001-101098023 TATAACACTGAACCTGAACATGG + Intronic
1192606693 X:72526100-72526122 TAGTCCAAACTACCTGAACATGG + Intronic
1193363896 X:80608027-80608049 TCTTACACACTACCAGAATAGGG + Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic