ID: 1097772825

View in Genome Browser
Species Human (GRCh38)
Location 12:63608766-63608788
Sequence GTGATAGCTGAGATGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 4, 1: 0, 2: 0, 3: 12, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097772825_1097772832 18 Left 1097772825 12:63608766-63608788 CCCTGTTCCATCTCAGCTATCAC 0: 4
1: 0
2: 0
3: 12
4: 210
Right 1097772832 12:63608807-63608829 ACTGTTGATTTTTCAAATTTTGG 0: 2
1: 2
2: 5
3: 65
4: 795
1097772825_1097772833 29 Left 1097772825 12:63608766-63608788 CCCTGTTCCATCTCAGCTATCAC 0: 4
1: 0
2: 0
3: 12
4: 210
Right 1097772833 12:63608818-63608840 TTCAAATTTTGGACAAATTTTGG 0: 2
1: 1
2: 9
3: 62
4: 664

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097772825 Original CRISPR GTGATAGCTGAGATGGAACA GGG (reversed) Intronic
901879079 1:12183337-12183359 GAGATAACAGAGATGGAAAAAGG - Intronic
903580725 1:24368472-24368494 GTGAGAGCTGAGATGGTAACAGG + Intronic
905260309 1:36712759-36712781 GTGATAGGGGAGAGTGAACAGGG + Intergenic
909532261 1:76694278-76694300 GTGAGGGATGTGATGGAACATGG - Intergenic
909735262 1:78951161-78951183 CTGTAAGCTGAGATGGAACCTGG - Intronic
912343847 1:108945450-108945472 TTCCCAGCTGAGATGGAACAAGG - Intronic
913521739 1:119650986-119651008 GTGGTAGCTGAGAAGGAAGTCGG + Intergenic
916055668 1:161067691-161067713 GAGAGGGCTGAGATGGAGCAAGG + Intronic
917528913 1:175815457-175815479 GTCAGAGCTGAGATTGAGCAAGG + Intergenic
919095202 1:193025614-193025636 GTGACAACTGAAATGGAATAAGG - Intronic
919788256 1:201274101-201274123 GTGATAGTTGAGACAGAACTTGG - Intergenic
920417677 1:205809788-205809810 GGGAGAGGAGAGATGGAACAGGG - Intronic
921309071 1:213824949-213824971 GGGATAGCTGACAAGGCACAAGG + Intergenic
922859187 1:228801295-228801317 TTCCTAGCTGAGGTGGAACAAGG - Intergenic
922878874 1:228964049-228964071 GTCATAGCTGAGCTGGACCTTGG + Intergenic
1063256428 10:4332370-4332392 GTGATAGAGAAGAGGGAACAAGG - Intergenic
1063897932 10:10701770-10701792 GTGATGGCAGAAATGGAAAATGG - Intergenic
1064155944 10:12903259-12903281 GTGATAGCTGGGATGCCAGAGGG - Intronic
1065982932 10:30920043-30920065 GAGACAGATGAGATGGAAAATGG - Intronic
1066284782 10:33954152-33954174 GTTATACCTGACATGGTACAAGG - Intergenic
1066710438 10:38227656-38227678 GTGAGAGCTGAGATGGGAGGCGG + Intergenic
1068196067 10:53718238-53718260 TTGATGCCTGAGATGGTACAGGG - Intergenic
1072572091 10:96667188-96667210 GTGAAAGCTCAGTTGGAAAATGG - Intronic
1074088278 10:110225404-110225426 GTGGAAGCTGAGGTGGAAGAAGG + Intronic
1075258616 10:120944636-120944658 GTGATGGCTCAGCTGGAACTGGG - Intergenic
1075325985 10:121532615-121532637 GTGATAGCTGAGCTGGGGCCAGG - Intronic
1075467899 10:122665077-122665099 GTGAGAGCTGTGAAGGAAAAGGG + Intergenic
1078980699 11:16529738-16529760 CTGATACCTGAGAATGAACAAGG - Intronic
1080168965 11:29275787-29275809 GAGACTGCTGAGATGGAAAAGGG + Intergenic
1080187899 11:29512662-29512684 GTGAGAGGTGAGATGGAAAGAGG - Intergenic
1081695128 11:45104465-45104487 GTGATAGCTGAGTGAGACCATGG + Intronic
1085707840 11:78802520-78802542 GTGACAGCTGAGGAGGAACGTGG + Intronic
1086321404 11:85651511-85651533 GTGACAGCTGAGATGAAAAGAGG + Intronic
1087049548 11:93871622-93871644 GAGATAACTGAGGTGGATCAAGG + Intergenic
1087958714 11:104321856-104321878 GAGAAGGCTGAGTTGGAACATGG + Intergenic
1088184225 11:107146451-107146473 TTGGTAGCTGAGGTGCAACAGGG + Intergenic
1088843382 11:113644942-113644964 GTAATAGCTGAGGTGGAAGGAGG + Intergenic
1089150045 11:116357365-116357387 CTGATGGCTGAGAGGGAGCAGGG - Intergenic
1089368766 11:117938476-117938498 GTGATATGTGAGATGGATCTTGG + Intergenic
1090862397 11:130665676-130665698 AAGATAGCTGAGATGTCACATGG + Intergenic
1092872319 12:12816590-12816612 GTTATAGCTGAGATTGGAAATGG + Intronic
1093781681 12:23144563-23144585 GTGATATCTGGGAAGGAATAGGG - Intergenic
1094065518 12:26357431-26357453 GTGAGGTCTGAGAGGGAACATGG - Intronic
1094144831 12:27217437-27217459 ATGATAGCAGAGTAGGAACATGG - Intergenic
1095880298 12:47129010-47129032 ATGATAGCAGAGATGGAGAAAGG - Intronic
1097772825 12:63608766-63608788 GTGATAGCTGAGATGGAACAGGG - Intronic
1100562139 12:95757872-95757894 TTGAGAGCTTAGATGGAATAAGG + Intronic
1103931131 12:124451688-124451710 GTGAGTGATCAGATGGAACAGGG + Intronic
1106413896 13:29529905-29529927 GAGAGACCTGAGATGGCACAGGG + Intronic
1107959527 13:45545814-45545836 TTGCTGGCTGAGATTGAACAAGG - Intronic
1108585007 13:51863458-51863480 GTCATGGGGGAGATGGAACAGGG + Intronic
1110720009 13:78750852-78750874 GTGACTGCTGAGATGGCAGAAGG - Intergenic
1112779529 13:102883549-102883571 GTGATGGTGGAAATGGAACAAGG - Intergenic
1114799422 14:25756308-25756330 GACCTAGCTGAGGTGGAACAAGG - Intergenic
1115091591 14:29583288-29583310 TAAATAGCAGAGATGGAACAAGG + Intronic
1116605638 14:46990219-46990241 GTAATAGCTGAGAGGGAGTAAGG - Intronic
1118120767 14:62839444-62839466 GTGACAGCACAGATGGCACAGGG - Intronic
1118920646 14:70146646-70146668 TTCATAGCTGAAGTGGAACAAGG + Intronic
1118967627 14:70602413-70602435 GTGATACCTGAGATGAGACCTGG + Intergenic
1119498369 14:75100731-75100753 GTGAAAGCTGAAATGAAAAAAGG + Intronic
1121343461 14:93118319-93118341 GTGAGAGCTGAGAGGGAAATGGG + Intergenic
1121635433 14:95450861-95450883 GTGTTAGATGAGATGACACATGG + Intronic
1122801120 14:104229997-104230019 GTGATGGCTGAGGACGAACAAGG + Intergenic
1125257330 15:37780139-37780161 TTACTAGCTGAGATTGAACAAGG - Intergenic
1125461525 15:39911675-39911697 GTGATAACTGAGAGGGTTCAGGG + Intronic
1125492741 15:40160351-40160373 GTGATAGCTCAGATGTGACCAGG - Intergenic
1125798792 15:42425825-42425847 GTGAGAGATGACATGGAACCAGG - Intronic
1126313173 15:47339499-47339521 GTGAGAGCAGAGAAGAAACATGG + Intronic
1127536933 15:59898994-59899016 GTGAGAGCTGGCCTGGAACAGGG - Intergenic
1129891899 15:79077066-79077088 GGGATAGCTGACAGGGCACAGGG + Intronic
1131350367 15:91694080-91694102 GTGAGAGAGGAAATGGAACAGGG + Intergenic
1131482879 15:92797025-92797047 CATATAGCAGAGATGGAACAAGG - Intronic
1131698263 15:94903772-94903794 GGCAGAGCTGGGATGGAACATGG - Intergenic
1132567370 16:629699-629721 GTCACAGCTGAGCTGGAACGGGG + Intronic
1132862396 16:2078110-2078132 GTTGTAGCTGAAAGGGAACAAGG + Intronic
1134410824 16:14001902-14001924 GTAATAATTGAGTTGGAACAAGG - Intergenic
1134809329 16:17153965-17153987 GACAGAGCTGAGATGGAACCTGG - Intronic
1137365101 16:47853444-47853466 CTTAGGGCTGAGATGGAACAGGG - Intergenic
1138991878 16:62399921-62399943 TTCACAGCTGAGATTGAACAAGG - Intergenic
1139061294 16:63255065-63255087 GTGATAGCTAAGATGCATCTTGG + Intergenic
1139187779 16:64827424-64827446 GAGCTAGGTGAGCTGGAACATGG - Intergenic
1141221152 16:82070378-82070400 GGGATAGCCGAGGTGGAAGAAGG - Intronic
1141983196 16:87562362-87562384 GTGACAGGTGAGATGGCAGATGG + Intergenic
1142642092 17:1290041-1290063 GTGAAAGATGAGATGGAGTATGG - Intronic
1144412777 17:15017713-15017735 GTGACAGCTAAGATGATACAAGG - Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1147532888 17:41296678-41296700 GTTATATCTGAGATGAAAAAAGG + Intergenic
1147820328 17:43237768-43237790 GTGATAGCTGAGGAGGAGCGGGG - Intergenic
1147822431 17:43249650-43249672 GTGATAGCTGAGGAGGAGCGGGG - Intergenic
1147823356 17:43255098-43255120 GTGATAGCTGAGGAGGAGCGGGG - Intergenic
1147824398 17:43261298-43261320 GTGATAGCTGAGGAGGAGCGGGG - Intergenic
1147824941 17:43264440-43264462 GTGATAGCTGAGGAGGAGCGGGG - Intergenic
1147828062 17:43281962-43281984 GTGATAGCTGAGGAGGAGCGGGG - Intergenic
1147829172 17:43288126-43288148 GTGATAGCTGAGGAGGAGCGGGG - Intergenic
1147830268 17:43294266-43294288 GTGATAGCTGAGGAGGAGCGGGG - Intergenic
1147939052 17:44032813-44032835 GTGGTAGCGGAGCTGGAAGAAGG - Intergenic
1148334775 17:46833900-46833922 TTGATACCTGGGATGGGACATGG - Intronic
1148772005 17:50072720-50072742 GTGATTGCAGGGATGGAGCAAGG + Intronic
1149449129 17:56735995-56736017 GTGATCGCTGTAATGGAAGAAGG + Intergenic
1149452769 17:56762823-56762845 GTGAGATCTGGCATGGAACATGG - Intergenic
1152032345 17:77851736-77851758 GAGAGAGCTGAGAAGGAACACGG - Intergenic
1152765290 17:82134066-82134088 GTGTTACCTGAGATGTAAAATGG + Intronic
1158329127 18:56342302-56342324 GTAATAGCTGAAATGTAGCATGG - Intergenic
1158821237 18:61161470-61161492 GTGATAGCTGCGATGTCACATGG - Intergenic
1159718083 18:71849989-71850011 ATGATATCTGAGAGGGACCAGGG + Intergenic
1163246677 19:16099710-16099732 GTGATGGCTGATAAGGGACAAGG - Intronic
1163575055 19:18105960-18105982 GGGACATCTGAGATGGGACAGGG + Intronic
1165784945 19:38455841-38455863 GTGAGAGATGAGATGGAGGAGGG - Intronic
1166467405 19:43044505-43044527 CTGGTTGCTGACATGGAACAGGG - Intronic
1166473539 19:43100586-43100608 CTGGTTGCTGACATGGAACAGGG - Intronic
1166915954 19:46196295-46196317 GTGGTGGCTGAGATGGGAGATGG - Intergenic
1166918672 19:46213517-46213539 GTGGTGGCTGAGATGGGAGATGG - Intergenic
1166925087 19:46261494-46261516 GTGGTGGCTGAGATGGGAGATGG + Intergenic
1166981182 19:46633229-46633251 GTGACATCTGAGCTGGAACATGG - Intergenic
1168567790 19:57439321-57439343 TTGGGAGCTGAGATGGAAGAGGG + Intronic
925626318 2:5845126-5845148 GTGTTAGCTGAGATAGTTCAGGG - Intergenic
926598244 2:14813979-14814001 GTCATAGCTAAAATGGATCAAGG + Intergenic
926921046 2:17940574-17940596 GTCATAGAGGAGATGAAACATGG + Intronic
930760811 2:55033490-55033512 TTCCCAGCTGAGATGGAACAAGG + Intronic
933143710 2:78825076-78825098 GTGAAAGCTGAAATAGAATAGGG + Intergenic
933233120 2:79832116-79832138 GTGATAGATGAGATTGAAGTTGG - Intronic
933653751 2:84870595-84870617 GTGAGAGCTGAGATGGTATAGGG + Exonic
934772343 2:96915024-96915046 GTGTTTGCTGAGATGGAAAATGG + Intronic
937180715 2:119993768-119993790 GTGATAGGTGAGGAGGAAGACGG + Intergenic
938612848 2:132966980-132967002 TTACTAGCTGAGATGGAGCAAGG - Intronic
939008860 2:136821505-136821527 CTGGTGGCTGAGTTGGAACAGGG + Intronic
942367840 2:175247334-175247356 GCAAGAGCAGAGATGGAACATGG + Intergenic
945996087 2:216437393-216437415 ATGATAGCTGAAATGGAATAGGG + Intronic
948899562 2:240949503-240949525 GTGATGGGTGAGATGCACCAGGG - Intronic
1172609683 20:36240619-36240641 GTGCTTGGTGAGAAGGAACAAGG + Exonic
1172897313 20:38309523-38309545 GTGATAGCAGAGGTGTAAAAAGG + Intronic
1173632470 20:44526945-44526967 GTGACAGCTGAGAGGGAAAATGG + Intergenic
1175319170 20:58073319-58073341 GTGAGAAGTGAGAAGGAACACGG - Intergenic
1175649475 20:60706038-60706060 GGGAATTCTGAGATGGAACATGG - Intergenic
1175687808 20:61044209-61044231 GTGGAAGCTGACATTGAACATGG + Intergenic
1175699835 20:61128934-61128956 TTGATGGCAGAGATGGAAGAGGG + Intergenic
1176896818 21:14388936-14388958 GTAATAGCTGAGATGCAAGGAGG + Intergenic
1179065905 21:38024728-38024750 GTGATACCTGAGCAGGAAGAAGG + Intronic
1180717595 22:17882313-17882335 GTGATAGCTGAGTTGACAGAAGG - Intronic
1180990251 22:19931485-19931507 ATGAAAGGTGAGAAGGAACACGG + Intronic
1181298754 22:21863881-21863903 GGGATTTCTGAGATAGAACAAGG - Intronic
949518456 3:4828064-4828086 GATAAAGCTGAGATGGAACGTGG + Intronic
952039303 3:29242119-29242141 CTGATAACTGAGATGAAAAAAGG + Intergenic
952190612 3:31019093-31019115 GTGATGGCAGAAATGCAACAGGG + Intergenic
953012312 3:39039122-39039144 ATGATAGATGACATGGAAAATGG + Intergenic
953812390 3:46124533-46124555 GTGTAAGAGGAGATGGAACATGG - Intergenic
954870085 3:53761213-53761235 GCAAAAGCTGAGATGGAAGAAGG + Intronic
955573916 3:60338073-60338095 GTCATACCTGAGATGCAGCAGGG + Intronic
956088820 3:65641961-65641983 GTGATCGATGACAAGGAACAAGG + Intronic
956664859 3:71632582-71632604 GTGACATCTGAGCTGGAACCTGG + Intergenic
959004188 3:101001094-101001116 GTGATAGGTGAGAGGGAAGTGGG - Intergenic
959442813 3:106399523-106399545 CAGATAGCAAAGATGGAACAAGG - Intergenic
960057414 3:113285248-113285270 GTGAGAGCTCAGATGGGGCAAGG - Intronic
960434334 3:117607295-117607317 GTAATATCTGAGATATAACATGG - Intergenic
961536369 3:127573333-127573355 GTGAGAGCAGAGATGGCAAAGGG + Exonic
962659072 3:137582586-137582608 GTTAAGGCTGAGATGGAAGAAGG - Intergenic
963784033 3:149515053-149515075 GTGGGAGCTGAGACCGAACAAGG - Intergenic
963860841 3:150308676-150308698 ATGACAGCTGAGATGCAACCTGG - Intergenic
966235133 3:177692321-177692343 GAAATTACTGAGATGGAACAGGG + Intergenic
966312346 3:178607881-178607903 TTGCTAGCTGAGTAGGAACATGG - Intronic
967201036 3:187072766-187072788 GTAATAGCTGACATAGCACAAGG - Intronic
967464443 3:189787557-189787579 CTGATAGCTGAGGTGGCACATGG + Intronic
969878476 4:10153865-10153887 GTGAAAGCTGATATGGGACCTGG + Intergenic
973643309 4:52924912-52924934 TTGATAGATAAGATGGAATATGG + Intronic
974166317 4:58208443-58208465 GAGATAGCAGAAATGGAATAGGG + Intergenic
975735219 4:77373901-77373923 GTGAGAGGTCAAATGGAACAAGG - Intronic
976972761 4:91127838-91127860 GTTATAGATGAGTTGGAATATGG + Intronic
977201492 4:94121786-94121808 CTGAAAGCTGAGAAGGAGCAGGG - Intergenic
978395273 4:108272424-108272446 GTGTTTGCTGAAGTGGAACAGGG - Intergenic
978740585 4:112133244-112133266 GTGAAAACTGAGATGGAAAGGGG + Intergenic
980086110 4:128391709-128391731 GTGATAGCAAACATGGAGCATGG + Intergenic
981158673 4:141470994-141471016 GTGACAGCCTAGAAGGAACACGG - Intergenic
982258783 4:153475038-153475060 GTGAAAGCAGAGGTGGAAAATGG - Intronic
983793964 4:171836767-171836789 GTGATGGCTATGATGGAAGATGG + Intronic
984566028 4:181331057-181331079 GTGAAAGCTGAGTTGGCAAAAGG - Intergenic
993560401 5:89400404-89400426 GATATAGCTGAGATGAAACTAGG - Intergenic
994100854 5:95891021-95891043 GTGATGGCTGAGGTTGAGCAGGG + Intronic
994174255 5:96693790-96693812 GTGATATGTGAGATGGTAAAAGG - Intronic
996588648 5:125120373-125120395 AAGATTGCTGAGATGGAAGATGG + Intergenic
998165495 5:139840283-139840305 GTGGGAGCTGGGAGGGAACAGGG + Intronic
1000101669 5:158022681-158022703 GGGATAGCAGAAATGGAAGAGGG - Intergenic
1007965871 6:46003337-46003359 GAGATAGCGGGGATGGAAGAGGG - Intronic
1008202444 6:48607688-48607710 GAGAAAACTGAGATGGAGCAAGG + Intergenic
1014650192 6:124026784-124026806 GTGATAGCTAACATGCAACATGG - Intronic
1015060906 6:128964220-128964242 GTGATATCTGACATGGGAAAGGG + Intronic
1015689151 6:135901517-135901539 GTGGGAGCTGAGATGGAATTGGG + Intronic
1017933229 6:158978900-158978922 GTGCAATCTGAGATGGATCAGGG + Intronic
1018585400 6:165351763-165351785 GTGTTAGCTGAGATTGATCGAGG + Intronic
1022365409 7:29709901-29709923 GTGATAGCTGAGATGGAACAGGG + Intergenic
1022932389 7:35132460-35132482 GTGATAGCTGAGATGGAACAGGG - Intergenic
1023402408 7:39800135-39800157 GTGAGAGCTTATATGAAACACGG - Intergenic
1023653099 7:42390870-42390892 GTGACAGCAGAGGTGGAGCACGG - Intergenic
1023760240 7:43458995-43459017 GGAATGGCTGAGTTGGAACATGG - Intronic
1024647211 7:51380530-51380552 GTGAGAGCTTATATGAAACATGG + Intergenic
1028632982 7:92956085-92956107 GTGATAGATAACAGGGAACAGGG - Intergenic
1029828315 7:103225255-103225277 GTGATAGCTGAGATGGAACAGGG - Intergenic
1030907812 7:115207916-115207938 GTGGAAGCGGAGAAGGAACAAGG + Intergenic
1034512352 7:151546451-151546473 GTGATTGCTGAGGTGGAGCAAGG + Intergenic
1036797898 8:11769449-11769471 GTGAAAGCAGGGATGGAAGAAGG - Intergenic
1038568257 8:28637750-28637772 TTGATGGATGAGATGGGACAAGG - Intronic
1039218549 8:35301127-35301149 CTGATTCCAGAGATGGAACAGGG + Intronic
1039950509 8:42168138-42168160 GTTATAGCTGAGAATGCACATGG - Intronic
1040772628 8:50996802-50996824 GCGGTATCTGGGATGGAACACGG - Intergenic
1044753911 8:95442402-95442424 GTGATAGGAGAGAAGGAGCAGGG - Intergenic
1047537688 8:125734500-125734522 CTGATAGCTGAGCAGGAAGAGGG - Intergenic
1047784203 8:128137884-128137906 CTGAGAGCTGAGATGGGAGAGGG + Intergenic
1047849129 8:128837441-128837463 GGGAGGGCAGAGATGGAACATGG + Intergenic
1049318235 8:141981060-141981082 GGGTAAGCTGAGCTGGAACATGG + Intergenic
1052337488 9:27335263-27335285 GTTATAGCTGGGAGGAAACATGG + Intronic
1052955329 9:34249573-34249595 GTGCCAGCTGAGAGGGAAAAAGG - Intronic
1053010172 9:34628392-34628414 GTGAAAATAGAGATGGAACAGGG + Intergenic
1053291883 9:36885664-36885686 GTGGTTGCAGAGATGGCACAGGG - Intronic
1058756726 9:108089424-108089446 GTGATAGCTGGGGTGAAACATGG - Intergenic
1059177933 9:112184292-112184314 GAGATAGCAGAGATGGGAAAAGG - Intergenic
1059268310 9:113056534-113056556 GTGAGAGCTGTGATGAGACAGGG - Intronic
1060751245 9:126170854-126170876 GTGGGAGCTGGGATGGCACATGG + Intergenic
1061696830 9:132382223-132382245 GTGAGAAGTGAGATTGAACATGG - Intronic
1185561950 X:1066744-1066766 GTGGTAACTGAGATGAAACGGGG + Intergenic
1186235246 X:7500998-7501020 ATGATGGCAAAGATGGAACAAGG + Intergenic
1188858463 X:35226340-35226362 GTGATATCTGAGGTGGAAGAAGG + Intergenic
1189707234 X:43770995-43771017 GTGTTGACTAAGATGGAACATGG - Intronic
1192362493 X:70448551-70448573 GGGATGGCAGAGATGGAGCATGG - Intronic
1192824121 X:74677269-74677291 GAGATAGATGAGATGGGTCAGGG - Intergenic
1193423166 X:81308586-81308608 GGGATAGCTGCAAAGGAACATGG - Intergenic
1197695377 X:129544063-129544085 GTGATATTTGAGATGAAACTCGG + Intronic
1197905136 X:131416714-131416736 GTGTGAGATTAGATGGAACAGGG + Intergenic