ID: 1097776689

View in Genome Browser
Species Human (GRCh38)
Location 12:63655483-63655505
Sequence TAGGAAATACATAATGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 4, 1: 0, 2: 3, 3: 18, 4: 255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097776684_1097776689 4 Left 1097776684 12:63655456-63655478 CCAGGAAGTAGGCACCTGGGATA 0: 5
1: 0
2: 1
3: 15
4: 135
Right 1097776689 12:63655483-63655505 TAGGAAATACATAATGGGCATGG 0: 4
1: 0
2: 3
3: 18
4: 255
1097776681_1097776689 11 Left 1097776681 12:63655449-63655471 CCATATTCCAGGAAGTAGGCACC 0: 5
1: 0
2: 0
3: 13
4: 98
Right 1097776689 12:63655483-63655505 TAGGAAATACATAATGGGCATGG 0: 4
1: 0
2: 3
3: 18
4: 255
1097776686_1097776689 -10 Left 1097776686 12:63655470-63655492 CCTGGGATACAGCTAGGAAATAC 0: 4
1: 1
2: 0
3: 10
4: 130
Right 1097776689 12:63655483-63655505 TAGGAAATACATAATGGGCATGG 0: 4
1: 0
2: 3
3: 18
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097776689 Original CRISPR TAGGAAATACATAATGGGCA TGG Intronic
900888100 1:5429698-5429720 GAGGAAAAACAAAAGGGGCAGGG + Intergenic
902280147 1:15368325-15368347 TGGGAAATCAATAGTGGGCAAGG - Intronic
903519162 1:23934361-23934383 TGGGAAAGATATAATGGGAATGG + Intergenic
906444865 1:45887534-45887556 TAGGCACTGCATAGTGGGCAGGG + Intronic
906623096 1:47300867-47300889 TAGGAAGGACACAGTGGGCATGG - Intronic
908018015 1:59866638-59866660 TAGGAGATATGTAATGGGCGAGG + Intronic
908957976 1:69658800-69658822 CAGGAAATACACAATGGAAATGG + Intronic
908988654 1:70057464-70057486 TAGGCTAGACATAATGGGAATGG + Intronic
909137484 1:71819890-71819912 TAGCACATACATAATGGCCTTGG - Intronic
912047415 1:105476469-105476491 TAGGAAATGCAAAAGGGGCTGGG - Intergenic
913351612 1:117867396-117867418 AAGGAAATACAGGATGGGCACGG + Exonic
913707626 1:121442683-121442705 TATGAAATTAATAATGGGCTGGG + Intergenic
915832613 1:159145325-159145347 CAGAAAATGCATAATAGGCATGG - Intronic
916522274 1:165574739-165574761 TAGCAAATAAATAATGGAAATGG + Intergenic
916551449 1:165853620-165853642 TATGAAATACATTCTGGGTAAGG - Intronic
916952813 1:169798123-169798145 TCGGAAGTACAAACTGGGCATGG + Intronic
917861541 1:179149934-179149956 TAGGAAAAACATTTTGGGCCGGG + Intronic
919283601 1:195523578-195523600 AAGCAAAAACAAAATGGGCAAGG + Intergenic
921568138 1:216745479-216745501 AAGCAAAAACATATTGGGCATGG - Intronic
921873029 1:220161797-220161819 TAGGCAATACATTATGGGTGAGG + Intronic
922915040 1:229250285-229250307 TAAGAAATAGAGACTGGGCATGG - Exonic
923857500 1:237860700-237860722 TAGTAAATACATTTTGGGCCTGG - Intergenic
1062765468 10:59567-59589 TAGGTAATTCATAATGACCAAGG - Intergenic
1064069348 10:12212834-12212856 TTGCATATACATAATGGGGATGG - Intronic
1064459234 10:15517617-15517639 TCGAAAATACATAAAGGGCCAGG - Intronic
1064862357 10:19841271-19841293 TGAGAAATAAAGAATGGGCATGG - Intronic
1064985983 10:21210094-21210116 TAGGAAAAACATCATGGGCAGGG + Intergenic
1068007125 10:51404863-51404885 TAGGAAATAAATGGTGAGCAAGG + Intronic
1069200160 10:65604236-65604258 CAGGAAATAGATAAAGGGAAAGG + Intergenic
1074617203 10:115081225-115081247 TAAGAAATACAGAAAGGGCCAGG - Intergenic
1075162804 10:120039774-120039796 TAGGACATACATATTTGGCTGGG + Intergenic
1078682747 11:13494344-13494366 TAGGAAGTACATAATGAAGAGGG - Intronic
1078712236 11:13805212-13805234 TAGAACATACATAATGAGTAAGG + Intergenic
1078720726 11:13881034-13881056 CAGGAAATCCATAATGGGGCAGG + Intergenic
1078848144 11:15140296-15140318 GAGGAAATAAAGAGTGGGCAGGG - Intronic
1079255813 11:18828671-18828693 TAAAAAATACAGAATGGGCTGGG - Intergenic
1080087574 11:28303340-28303362 TAAGCAAAACATAATTGGCATGG - Intronic
1080352186 11:31398094-31398116 CAAGAAATACATATTGGGCCAGG - Intronic
1083560161 11:63667114-63667136 TACTAAATAACTAATGGGCATGG - Intronic
1085589871 11:77750039-77750061 AAAGAAATACAAAATGGGCCGGG - Intronic
1085653630 11:78291857-78291879 TAAAAAATACATAAGGGGCTGGG - Intronic
1085890259 11:80571036-80571058 TAGAACATACATAATGTGCCAGG + Intergenic
1087663558 11:101015613-101015635 TAGGAAAATTATTATGGGCAAGG + Intergenic
1088092833 11:106063635-106063657 TAAAAAATACATAATTGGCCGGG + Intronic
1089095796 11:115918969-115918991 TAGGAATTTGATAATGGGAAGGG + Intergenic
1092277903 12:7076169-7076191 TAGGAATTACACAATAGGGAGGG - Intergenic
1092818769 12:12333956-12333978 TAGGAAATAGAGGCTGGGCACGG + Intronic
1093560846 12:20538125-20538147 CAGCAAATACATAATGGAAAAGG - Intronic
1094421505 12:30276532-30276554 CAGGAAAAACATAATGCTCAAGG - Intergenic
1096309913 12:50511586-50511608 TAGAAAATACATGATTGGCCCGG - Intronic
1097111150 12:56659268-56659290 GATGAGATACATAATGGGAATGG + Intergenic
1097776689 12:63655483-63655505 TAGGAAATACATAATGGGCATGG + Intronic
1099896840 12:88659042-88659064 TAGGAAATAAAAAATGAGAAGGG - Intergenic
1101920146 12:108925792-108925814 GAGGAAATTCATCATGGGGAGGG - Intronic
1102648940 12:114423104-114423126 AAGGAAATAAATATTGGGCTGGG + Intergenic
1104372556 12:128236785-128236807 CAATACATACATAATGGGCATGG + Intergenic
1105868338 13:24481395-24481417 TAAGAAATACATTTTGGGCTGGG + Intronic
1106189630 13:27439762-27439784 AAGGGAAGAGATAATGGGCAGGG + Intronic
1106287878 13:28333970-28333992 TAGGAAATGCAAAATGGTGATGG + Intronic
1107077907 13:36343647-36343669 TAGCAAAGATATAATGGACATGG + Intronic
1107473962 13:40717053-40717075 TAAGAAATAGATAATAGGCTGGG + Intergenic
1107725208 13:43292352-43292374 TAGGAAAAAGATGATGGGCATGG + Intronic
1108012514 13:46033728-46033750 TATGAAATACACAATGTGCTGGG + Intronic
1108141991 13:47433352-47433374 TAGGAGATACATGGTGGGCGGGG - Intergenic
1108413732 13:50176535-50176557 TAGGTAATTCATAATGAGTATGG - Intronic
1109245815 13:59953537-59953559 TAGGAGATAAAGAATGGGTAAGG + Intronic
1110403203 13:75118434-75118456 TAGGGAAAAAATAATGGACATGG + Intergenic
1110426326 13:75371284-75371306 TAGAGAATACATAATGGTGAAGG + Intronic
1110735972 13:78937001-78937023 TAAGAGATAAATAAGGGGCAAGG - Intergenic
1111898964 13:94177591-94177613 TTTGAAATAAATAATAGGCATGG + Intronic
1112975527 13:105313321-105313343 TAGCAGAGACATAATGGGCCTGG - Intergenic
1113543481 13:111127361-111127383 TAGGAAATAAAAATTGGGCCAGG + Intronic
1113575362 13:111391353-111391375 TAGGAAAAACATAGTGTACATGG - Intergenic
1114963600 14:27927655-27927677 AAGGAAATACAAGGTGGGCAAGG + Intergenic
1114989307 14:28267372-28267394 AGGGCAATACATAATGGTCAAGG + Intergenic
1117417053 14:55506860-55506882 GAGGAAATAATTAATGGACAAGG - Intergenic
1117654581 14:57941548-57941570 GAGTAAATGCTTAATGGGCATGG + Intronic
1120232911 14:81858993-81859015 TAGGAAAGCAATAATGGTCACGG + Intergenic
1120326654 14:83037920-83037942 TTGGAACTAAGTAATGGGCAGGG - Intergenic
1121171260 14:91856326-91856348 TAAAAAATACAGAAAGGGCATGG + Intronic
1122260664 14:100519035-100519057 AAGGCAGTACATAGTGGGCATGG - Intronic
1125977542 15:43968314-43968336 TAGGAAATACTCCATTGGCAAGG - Intronic
1126432079 15:48597167-48597189 TAGAAAATATATAAGGAGCAAGG - Intronic
1126715010 15:51506357-51506379 TAAGAAATACAGGCTGGGCATGG - Intronic
1126857128 15:52849389-52849411 AAGGAAATACCTAAGGGCCAGGG - Intergenic
1127254079 15:57273604-57273626 TAGGAAAGACATAAAGAGCAGGG - Intronic
1127731931 15:61809603-61809625 TGGGAAATACAAAAGGGTCAAGG - Intergenic
1129541536 15:76352743-76352765 TAGAAAATACATTATGGACCAGG - Intronic
1130530493 15:84744355-84744377 TAGGAAATATATACTGAGAAGGG + Intergenic
1130673441 15:85932447-85932469 TAGCAACTCCAAAATGGGCAGGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1135657050 16:24259433-24259455 TAAGAAATACTGAATGGGAAAGG - Intronic
1135858798 16:26036404-26036426 CAGGAAATACAGATTGGGCAGGG - Intronic
1137243357 16:46679213-46679235 TAGGAAATACACAAAGGAGAAGG - Intronic
1138973091 16:62170403-62170425 TAGGACATACACAAAGGACAAGG - Intergenic
1140621396 16:76737518-76737540 TGGGAAATAGATAATGGCAATGG - Intergenic
1141458624 16:84162528-84162550 AAGGAAATACTGGATGGGCATGG + Intronic
1142783490 17:2200922-2200944 TAAAAAATAAATAATGGGCCGGG - Intronic
1143351895 17:6294972-6294994 TTGGAAATAGATAATGGTGATGG + Intergenic
1144801124 17:17928222-17928244 AAGGAAATAAATAAGGGGGAAGG + Intronic
1147762168 17:42805928-42805950 AAGGCAATACAAAATGTGCATGG + Intronic
1148508818 17:48150576-48150598 TAGGAAATAAATAATGAAAATGG - Intronic
1150466910 17:65401607-65401629 TAGCAAATACATCATGGCAAAGG + Intergenic
1151846387 17:76658838-76658860 TAGAAAATAGAAAATGGGCTGGG + Intergenic
1153742670 18:8145263-8145285 TAGGAACTACAAAATGGGGTGGG + Intronic
1156022277 18:32613521-32613543 TTGGAAATACATAGTGGTGATGG - Intergenic
1156514277 18:37666993-37667015 TAGGACAGAAATAAAGGGCAGGG + Intergenic
1157992813 18:52517838-52517860 TAGGAAATACATAGTGTTCTGGG + Intronic
1158363823 18:56707718-56707740 TAGGACATAAATTATGGGCTAGG + Intronic
1159149067 18:64496824-64496846 TAGGAACTAAATATTGGGTATGG - Intergenic
1159382371 18:67677127-67677149 TAGAAAACACATACTGTGCAAGG + Intergenic
1161753751 19:6116411-6116433 TAGAAAATACATTAAGGGCCAGG + Intronic
1163964224 19:20729611-20729633 TAAGAATTATATAATGGGGAGGG + Intronic
1165440251 19:35822180-35822202 GAGGAAATAAATAATTTGCAAGG - Intergenic
1166985222 19:46655773-46655795 CAGGAAATATTTAATGGGCTGGG + Intronic
925906453 2:8542704-8542726 TAGGAAATAGATGAGGGGGAGGG - Intergenic
925933413 2:8730148-8730170 TAGGAAGTACATAATGAAGAGGG - Exonic
926067526 2:9855523-9855545 TAAAAAATACGTACTGGGCATGG + Intronic
928175278 2:29029459-29029481 TAAGAATGACATAATGGGCCGGG + Intronic
928276383 2:29904286-29904308 TAGGCAATGCATAATGGGACAGG + Intronic
928977199 2:37100698-37100720 TAGGAAATACAAGATAGGAAAGG - Exonic
936411073 2:112258837-112258859 TTGGAAATACATAATGGTGATGG + Intergenic
938366829 2:130741162-130741184 TAGCAAATGCAGAAAGGGCACGG + Intergenic
939586996 2:144018045-144018067 TAGGAAAGACATAATAGAAATGG - Intronic
939642211 2:144654382-144654404 GAGGAAAGTCATAAGGGGCAGGG + Intergenic
942341116 2:174948564-174948586 TAGGAAGTACAAGATAGGCATGG + Intronic
942728614 2:179038421-179038443 TTGGAAATACATAGTGGTGATGG + Intronic
943028668 2:182660014-182660036 TACCAAATATATCATGGGCATGG + Intergenic
945558369 2:211307131-211307153 CAGGAAATAAACACTGGGCAGGG + Intergenic
946436876 2:219662912-219662934 TAGGAAATGCACAGTAGGCAAGG + Intergenic
948258153 2:236583611-236583633 TAGTAAATTCAAAATGGGGAGGG + Intergenic
1170182343 20:13546062-13546084 GATCAAATACATAAAGGGCAGGG + Intronic
1170380486 20:15754744-15754766 TAGGGTATACATAATGGCCAGGG - Intronic
1171354308 20:24532461-24532483 AAGGAACCACATCATGGGCATGG + Intronic
1173353553 20:42266272-42266294 TAGAAAATTGACAATGGGCATGG + Intronic
1173558695 20:43986216-43986238 CAGGAAAGATATAATGGGAAGGG + Intronic
1173676571 20:44840877-44840899 TAGGAAATACATACTGAGGCGGG + Intergenic
1174224222 20:48983916-48983938 CAGGAAATAAAAAATGGGCTGGG + Intronic
1176031123 20:63012568-63012590 AAGGAAAAACAGGATGGGCATGG - Intergenic
949252031 3:1996720-1996742 TAGGAAACACCTAATGGGCAAGG + Intergenic
949832729 3:8233216-8233238 TCTGAAATACAAAATGGGCATGG - Intergenic
951514097 3:23538987-23539009 TAGGAAATACTGAATGAGAAAGG + Intronic
952622754 3:35365727-35365749 TAGTAAATATATAAAGGGCATGG + Intergenic
953259687 3:41325618-41325640 TATAAAATATATAATAGGCAGGG + Intronic
953763985 3:45719117-45719139 TAAGAAACACAAAATGGGGAGGG - Intronic
953939408 3:47078679-47078701 TAGGAAATACACAATATCCAGGG + Intronic
954503235 3:51041510-51041532 TAAGAAATACATTTTGGGCCGGG - Intronic
955108782 3:55927060-55927082 TAGCAAAAACAGAATGGACAGGG - Intronic
955814141 3:62823992-62824014 CAGGCATTACATAATGTGCAAGG + Intronic
956208363 3:66777231-66777253 TAGTAAATAAATAATGTACAAGG - Intergenic
956684972 3:71817885-71817907 TATAAATTACATAATGGGCAGGG + Intergenic
957267025 3:77981311-77981333 CAGGATATACATAACAGGCAAGG + Intergenic
958668287 3:97168877-97168899 TCGGAAGTAAGTAATGGGCAGGG + Intronic
960102055 3:113754231-113754253 TAGGAAAAACAGGCTGGGCATGG + Intronic
960580069 3:119269594-119269616 AAGGAATTACATAATGGTAAAGG + Intergenic
964742855 3:159985773-159985795 TAGAAAATACTCAATGGGCTGGG - Intergenic
965454920 3:168887650-168887672 TAAGAGATAAATAATGGCCAAGG - Intergenic
966644628 3:182230582-182230604 TAAGAAATACATTTTGGGCCGGG - Intergenic
968150036 3:196330315-196330337 TTGGAAATAGATAATGGTAATGG + Intronic
968870154 4:3237975-3237997 CAGCAAAAACATAATGGGAACGG + Intronic
969134695 4:5020417-5020439 TTGGAAACACACAATGGGCCTGG - Intergenic
972199487 4:36696883-36696905 TAGGACAAACATCATGGGAAGGG - Intergenic
972299776 4:37773761-37773783 GAGGAAATACATGATGAGGAAGG + Intergenic
972920003 4:43927311-43927333 GAGTAAAAACATAATGGGCCGGG + Intergenic
974105680 4:57467147-57467169 TAAGAATCATATAATGGGCAGGG - Intergenic
974692764 4:65320458-65320480 TAGGAAAAACAAAATGAGAAAGG + Exonic
974778514 4:66520896-66520918 AAGAAAATACTTAATGGGCCAGG + Intergenic
974796864 4:66763835-66763857 TAGAAAATACATAATGTACAAGG - Intergenic
974871190 4:67645303-67645325 TAAGAAATACAGAATAGGCTGGG + Intronic
976408235 4:84683586-84683608 TAGGGAAAACATAGTGAGCAGGG - Intronic
977895794 4:102363441-102363463 CAGGAAATACATGGAGGGCAAGG + Intronic
978350727 4:107818156-107818178 TAGGAAATAAAAGATGGTCAGGG - Intergenic
979038507 4:115755475-115755497 TAGGCAAGACATATTGTGCAGGG - Intergenic
981452043 4:144909826-144909848 TAGGAAATATGGAAGGGGCAGGG + Intergenic
981773885 4:148342381-148342403 TAGGAAATTTGTAATGCGCAAGG + Intronic
981998010 4:150995675-150995697 TAGGAAGTACAAAAGGGCCATGG + Intronic
982019081 4:151185753-151185775 TCCTAAATTCATAATGGGCATGG + Intronic
982472306 4:155807771-155807793 CAGGAAATAAAGACTGGGCATGG + Intergenic
982547192 4:156748855-156748877 TAAGAAATTTATAATAGGCAGGG + Intergenic
982945536 4:161617865-161617887 TAAGAAATGCTTAATGGGGATGG + Intronic
983563217 4:169122273-169122295 TAGGAAAAACATAAAGAGAAAGG + Intronic
983812863 4:172085395-172085417 TATGAAATACATTACAGGCATGG + Intronic
984406013 4:179330978-179331000 TAGGAAATACATAAATTACATGG - Intergenic
984493907 4:180470794-180470816 AAGGCATTACATAATGGTCAAGG + Intergenic
984704545 4:182838228-182838250 TAGGAAATACAAAATTAGCTGGG - Intergenic
987088993 5:14494601-14494623 TAAGAAATACATTTTGGGCTGGG + Intronic
987364695 5:17138515-17138537 TAGAAAATAATGAATGGGCATGG + Intronic
989102077 5:37832924-37832946 TAGGACAAACATAAAGGCCAAGG + Intronic
989668410 5:43884833-43884855 AAGGAAAAACAAAATGGCCATGG - Intergenic
990140986 5:52703731-52703753 TAAAAAATACATACTGGGGAAGG + Intergenic
991674423 5:69076899-69076921 TAGAAAAGACATTATGGGCCGGG + Intergenic
991983678 5:72260363-72260385 TAGGAAATACATAATGCAAAGGG - Intronic
992033814 5:72751470-72751492 AAGGAAGTAGATAATGGGGAAGG + Intergenic
992585408 5:78233589-78233611 TAGGAAATACAGAATATGAAAGG + Intronic
994502158 5:100592863-100592885 TAGGAGAAACATAAGAGGCAAGG - Intergenic
996030355 5:118697964-118697986 TTGGAAACAGATAATGGGCATGG - Intergenic
996087472 5:119319837-119319859 TAGGAAGTACATAATTAACAAGG + Intronic
997097678 5:130931426-130931448 AAGGCAATACATAATGGTAAAGG + Intergenic
997802176 5:136874651-136874673 TAGGAGATATAAAATTGGCATGG - Intergenic
999105959 5:149071459-149071481 TAAGAAATACATGGTGGGCATGG + Intergenic
999806999 5:155090890-155090912 TTGGAAATAGATAATGGTTATGG + Intergenic
1000245957 5:159448764-159448786 TAGGAGATACTTAAAGGTCAGGG + Intergenic
1000823977 5:166021100-166021122 TTGGAAATTCATAATGTGCTGGG - Intergenic
1000948158 5:167447779-167447801 TAAGAAAGACAGCATGGGCAGGG - Intronic
1001265149 5:170268649-170268671 TAGGACAGAAAAAATGGGCAGGG - Intronic
1002693522 5:181068466-181068488 TAGAAAATACAGGCTGGGCATGG + Intergenic
1003914961 6:10778281-10778303 AAGTAAATACATAATGAGCAGGG + Intronic
1004540580 6:16545957-16545979 TAAGAAATAAAAAATGGGGAGGG + Intronic
1004600952 6:17149415-17149437 TAGGTAATACATTATGGATATGG + Intergenic
1005831169 6:29672375-29672397 AAGGAAATACATAAAAGACAAGG - Exonic
1008773353 6:55006776-55006798 AAGGCATTACATAATGGGAAAGG - Intergenic
1008902021 6:56631076-56631098 TAAGAAATACATTATTGGCTGGG - Intronic
1009279176 6:61724713-61724735 AAGGCAATACATAATGGTAAAGG + Intronic
1009382001 6:63043257-63043279 AAGGCATTACATAATGGTCAAGG - Intergenic
1009820890 6:68799686-68799708 GAGGAAATAGATAAAGGCCATGG + Intronic
1009888235 6:69650508-69650530 AAGGAAATAGATAATGGGTAAGG - Intergenic
1010849379 6:80752899-80752921 TAGGAAATACAAAATGAGAAGGG - Intergenic
1012300128 6:97577006-97577028 TATAATTTACATAATGGGCAGGG + Intergenic
1014222344 6:118810365-118810387 TGGGATATACATACTGGGCCAGG - Intergenic
1015975854 6:138790111-138790133 TAGGAAATACTTAAGTGTCATGG - Intronic
1016785341 6:148005431-148005453 TAGAAAAAACAAAAAGGGCAAGG - Intergenic
1018006937 6:159631108-159631130 CAGGAAAAACACAATGGGGAAGG + Intergenic
1018205187 6:161430518-161430540 TAAGAAATACTGAATGGGCCGGG + Intronic
1019052421 6:169193255-169193277 GAGGAAATACAGAGTGGGCTTGG - Intergenic
1019296621 7:280301-280323 GAGGAACTAGAAAATGGGCAAGG + Intergenic
1019836659 7:3392538-3392560 TTGGAAATAAATAATGGTGATGG - Intronic
1020704445 7:11526502-11526524 TAGTGCATACTTAATGGGCAGGG + Intronic
1020891957 7:13889209-13889231 TTGGAAATAGATAATGGTGATGG + Intergenic
1022361729 7:29666303-29666325 TAGGAAATACATAATGGGCACGG - Intergenic
1022699661 7:32747421-32747443 TAGGAAATACATAATGGGCATGG + Intergenic
1022935603 7:35173141-35173163 TAGGAAATACATAATAGGCCCGG + Intergenic
1024258099 7:47554121-47554143 TAAGAAATACATTTTGGGCCAGG + Intronic
1024922958 7:54579422-54579444 TAGAAAAAACATAATGGAAATGG + Intergenic
1025196049 7:56934692-56934714 TAAGAAATACATTTTGGGCCGGG + Intergenic
1025675898 7:63642244-63642266 TAAGAAATACATTTTGGGCCGGG - Intergenic
1026048674 7:66926197-66926219 TAGGGATTAAAAAATGGGCAAGG - Intronic
1026149987 7:67779773-67779795 TAGAAAATCCAAAATGGGCCTGG + Intergenic
1027429026 7:78090513-78090535 TAGGAAAACCATAGTGAGCAAGG - Intronic
1028351916 7:89859358-89859380 TAGCTAATACATCAAGGGCAGGG + Intergenic
1029831565 7:103265868-103265890 TAGGAAATACATAATGGGCATGG + Intergenic
1029856122 7:103518624-103518646 CAGGAAACACATGCTGGGCATGG - Intronic
1029950007 7:104573838-104573860 TGGGGAATTCATAATGGGAAAGG - Intronic
1030334680 7:108312122-108312144 TAGGAAATAAGAAATGGGGAAGG + Intronic
1032360575 7:131251194-131251216 TTGGAAATAGATAATGGTGATGG - Intronic
1035733665 8:1871904-1871926 CAGGAAAAAAATAATGGGCAAGG + Intronic
1035939796 8:3886342-3886364 TAAAAAATATATAATGGGCCTGG - Intronic
1036178580 8:6563478-6563500 TAGGAAATACTTAATTGGGGTGG - Intronic
1037677151 8:21060687-21060709 TAGAAAATACATAAAGCACAAGG - Intergenic
1038525331 8:28268011-28268033 TAGGACATGCATCAGGGGCAGGG + Intergenic
1038554744 8:28501053-28501075 TAGAAAACAGATACTGGGCAGGG - Intronic
1038980457 8:32753869-32753891 TGGGAAATACAAAAAGGCCAGGG + Intronic
1039136085 8:34324084-34324106 TAGAAAATCCAAAATGGGCTAGG + Intergenic
1039470672 8:37811805-37811827 TAGGAAATTTAAAATGGGCTGGG + Intronic
1040762430 8:50865671-50865693 TTGGAAATAGATAATGGTGATGG - Intergenic
1041058744 8:54015461-54015483 AAGAAAATAGATAATGGGCCAGG - Intronic
1041429905 8:57767617-57767639 CAGGAAACATAAAATGGGCATGG + Intergenic
1042210273 8:66373084-66373106 GAGGAAAGACATATTGGGCTTGG + Intergenic
1044845466 8:96376052-96376074 GAGCAGATAAATAATGGGCAGGG - Intergenic
1046808280 8:118504320-118504342 TAATAAATACATAAAGTGCAAGG + Intronic
1048068799 8:131000298-131000320 TAGTAAATAAATACTGGACAAGG + Intronic
1051283810 9:15473610-15473632 TAAGAAATACATAAATGGCCAGG + Intronic
1051468176 9:17404479-17404501 TAGGGAATCCAAAATGGCCAGGG - Intronic
1051918154 9:22231698-22231720 AAGGACATACATAATGGTAAAGG + Intergenic
1052183004 9:25553856-25553878 TAGGAAACACACCATGGACAGGG + Intergenic
1052572694 9:30247841-30247863 AAGAAAATACATACTGGGAAAGG - Intergenic
1053258815 9:36643085-36643107 TAAGAAATACAGCATGGGCTGGG + Intronic
1061232191 9:129321407-129321429 TTGGAAATCCACACTGGGCAGGG - Intergenic
1186809168 X:13170258-13170280 AAGGAAAGAAAGAATGGGCATGG - Intergenic
1187435860 X:19268285-19268307 CAGAAAATACATAATAGGCTGGG + Intergenic
1187546231 X:20255391-20255413 TAGGAAATAGATAGTGGTGATGG + Intronic
1188795018 X:34452972-34452994 TAGGGAATGCCTAATAGGCATGG + Intergenic
1189156748 X:38765519-38765541 TAGGTAATTCATAATGCACATGG - Intergenic
1190994586 X:55593819-55593841 TAGAAAATACATAATTGCCGTGG - Intergenic
1192729545 X:73789281-73789303 AAGGACATACATAATGGTAAAGG - Intergenic
1193504124 X:82318984-82319006 TATGAAAGACAAAATGGGGAGGG - Intergenic
1194130591 X:90076192-90076214 TATGAAGTACATAATTTGCATGG - Intergenic
1194411431 X:93563262-93563284 AAGTAAATACATAGTGGGCATGG + Intergenic
1197731867 X:129817556-129817578 TTGGAAATAGATAATGGTGATGG - Intronic
1199040500 X:143110288-143110310 GAGGAAACAACTAATGGGCATGG - Intergenic
1199101857 X:143811257-143811279 AAGGACATACATAATGGGATGGG - Intergenic