ID: 1097783556

View in Genome Browser
Species Human (GRCh38)
Location 12:63734653-63734675
Sequence GCTAGGACATTGGTCTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097783556_1097783558 -9 Left 1097783556 12:63734653-63734675 CCAGAAAAGACCAATGTCCTAGC No data
Right 1097783558 12:63734667-63734689 TGTCCTAGCTCAAAGCAGTCAGG No data
1097783556_1097783561 14 Left 1097783556 12:63734653-63734675 CCAGAAAAGACCAATGTCCTAGC No data
Right 1097783561 12:63734690-63734712 GAGTAGTTCCCTCATATTTGAGG No data
1097783556_1097783559 -8 Left 1097783556 12:63734653-63734675 CCAGAAAAGACCAATGTCCTAGC No data
Right 1097783559 12:63734668-63734690 GTCCTAGCTCAAAGCAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097783556 Original CRISPR GCTAGGACATTGGTCTTTTC TGG (reversed) Intergenic
No off target data available for this crispr