ID: 1097783558

View in Genome Browser
Species Human (GRCh38)
Location 12:63734667-63734689
Sequence TGTCCTAGCTCAAAGCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097783552_1097783558 28 Left 1097783552 12:63734616-63734638 CCCAAGAAGAGCCAATGTTTCAG No data
Right 1097783558 12:63734667-63734689 TGTCCTAGCTCAAAGCAGTCAGG No data
1097783553_1097783558 27 Left 1097783553 12:63734617-63734639 CCAAGAAGAGCCAATGTTTCAGT No data
Right 1097783558 12:63734667-63734689 TGTCCTAGCTCAAAGCAGTCAGG No data
1097783554_1097783558 17 Left 1097783554 12:63734627-63734649 CCAATGTTTCAGTCTGAGTCTAA No data
Right 1097783558 12:63734667-63734689 TGTCCTAGCTCAAAGCAGTCAGG No data
1097783556_1097783558 -9 Left 1097783556 12:63734653-63734675 CCAGAAAAGACCAATGTCCTAGC No data
Right 1097783558 12:63734667-63734689 TGTCCTAGCTCAAAGCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097783558 Original CRISPR TGTCCTAGCTCAAAGCAGTC AGG Intergenic
No off target data available for this crispr