ID: 1097783561

View in Genome Browser
Species Human (GRCh38)
Location 12:63734690-63734712
Sequence GAGTAGTTCCCTCATATTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097783556_1097783561 14 Left 1097783556 12:63734653-63734675 CCAGAAAAGACCAATGTCCTAGC No data
Right 1097783561 12:63734690-63734712 GAGTAGTTCCCTCATATTTGAGG No data
1097783560_1097783561 -3 Left 1097783560 12:63734670-63734692 CCTAGCTCAAAGCAGTCAGGGAG No data
Right 1097783561 12:63734690-63734712 GAGTAGTTCCCTCATATTTGAGG No data
1097783557_1097783561 4 Left 1097783557 12:63734663-63734685 CCAATGTCCTAGCTCAAAGCAGT No data
Right 1097783561 12:63734690-63734712 GAGTAGTTCCCTCATATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097783561 Original CRISPR GAGTAGTTCCCTCATATTTG AGG Intergenic
No off target data available for this crispr