ID: 1097783867

View in Genome Browser
Species Human (GRCh38)
Location 12:63737845-63737867
Sequence TGCCCACTCAGACCCCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097783860_1097783867 27 Left 1097783860 12:63737795-63737817 CCTAAGAGTCTCTCCCAGGTGCT No data
Right 1097783867 12:63737845-63737867 TGCCCACTCAGACCCCAAAGTGG No data
1097783862_1097783867 14 Left 1097783862 12:63737808-63737830 CCCAGGTGCTCACAAGGCAGAGA No data
Right 1097783867 12:63737845-63737867 TGCCCACTCAGACCCCAAAGTGG No data
1097783863_1097783867 13 Left 1097783863 12:63737809-63737831 CCAGGTGCTCACAAGGCAGAGAA No data
Right 1097783867 12:63737845-63737867 TGCCCACTCAGACCCCAAAGTGG No data
1097783859_1097783867 28 Left 1097783859 12:63737794-63737816 CCCTAAGAGTCTCTCCCAGGTGC No data
Right 1097783867 12:63737845-63737867 TGCCCACTCAGACCCCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097783867 Original CRISPR TGCCCACTCAGACCCCAAAG TGG Intergenic
No off target data available for this crispr