ID: 1097784335

View in Genome Browser
Species Human (GRCh38)
Location 12:63742484-63742506
Sequence ATGGATGAGCAAGACCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097784335_1097784342 7 Left 1097784335 12:63742484-63742506 CCAAGATGGTCTTGCTCATCCAT No data
Right 1097784342 12:63742514-63742536 TTTGGTGCTGGCTGTCAACCTGG No data
1097784335_1097784340 -5 Left 1097784335 12:63742484-63742506 CCAAGATGGTCTTGCTCATCCAT No data
Right 1097784340 12:63742502-63742524 TCCATCTGGGGCTTTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097784335 Original CRISPR ATGGATGAGCAAGACCATCT TGG (reversed) Intergenic
No off target data available for this crispr