ID: 1097784340

View in Genome Browser
Species Human (GRCh38)
Location 12:63742502-63742524
Sequence TCCATCTGGGGCTTTGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097784333_1097784340 16 Left 1097784333 12:63742463-63742485 CCTCAACTAGGGCTGGAGGGTCC No data
Right 1097784340 12:63742502-63742524 TCCATCTGGGGCTTTGGTGCTGG No data
1097784335_1097784340 -5 Left 1097784335 12:63742484-63742506 CCAAGATGGTCTTGCTCATCCAT No data
Right 1097784340 12:63742502-63742524 TCCATCTGGGGCTTTGGTGCTGG No data
1097784332_1097784340 17 Left 1097784332 12:63742462-63742484 CCCTCAACTAGGGCTGGAGGGTC No data
Right 1097784340 12:63742502-63742524 TCCATCTGGGGCTTTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097784340 Original CRISPR TCCATCTGGGGCTTTGGTGC TGG Intergenic
No off target data available for this crispr