ID: 1097785479

View in Genome Browser
Species Human (GRCh38)
Location 12:63754102-63754124
Sequence TGTCTGCCAATTCTCCATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097785479_1097785480 1 Left 1097785479 12:63754102-63754124 CCTAAATGGAGAATTGGCAGACA No data
Right 1097785480 12:63754126-63754148 AATTTTAAACTGAGAGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097785479 Original CRISPR TGTCTGCCAATTCTCCATTT AGG (reversed) Intergenic
No off target data available for this crispr