ID: 1097785480

View in Genome Browser
Species Human (GRCh38)
Location 12:63754126-63754148
Sequence AATTTTAAACTGAGAGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097785478_1097785480 2 Left 1097785478 12:63754101-63754123 CCCTAAATGGAGAATTGGCAGAC No data
Right 1097785480 12:63754126-63754148 AATTTTAAACTGAGAGACAGAGG No data
1097785479_1097785480 1 Left 1097785479 12:63754102-63754124 CCTAAATGGAGAATTGGCAGACA No data
Right 1097785480 12:63754126-63754148 AATTTTAAACTGAGAGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097785480 Original CRISPR AATTTTAAACTGAGAGACAG AGG Intergenic
No off target data available for this crispr