ID: 1097788961

View in Genome Browser
Species Human (GRCh38)
Location 12:63793672-63793694
Sequence TAGTAGAAATGGAGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 767
Summary {0: 1, 1: 4, 2: 9, 3: 92, 4: 661}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097788957_1097788961 7 Left 1097788957 12:63793642-63793664 CCTTTAGCTACAGGTAAGCTGCC 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG 0: 1
1: 4
2: 9
3: 92
4: 661

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097788961 Original CRISPR TAGTAGAAATGGAGAGAAGT GGG Intronic
900037136 1:423881-423903 TAGTGGAAATAGAGATAAGGAGG + Intergenic
900058766 1:659622-659644 TAGTGGAAATAGAGATAAGGAGG + Intergenic
900487457 1:2930102-2930124 TGGTGGAAAAGGAGAGAAGCCGG + Intergenic
900908930 1:5580425-5580447 TAGTTGAAATGGAGTCAAGTGGG - Intergenic
902340670 1:15781626-15781648 AAGTAGAAATGGTGAGATGTGGG - Intronic
902997801 1:20240487-20240509 GAGTGGATATGGAGAGAATTGGG + Intergenic
903064562 1:20691925-20691947 TAGCAAAGATGGAGAGAAGTGGG - Intronic
903311715 1:22463860-22463882 CATTAGAAATGGAGAGAATCTGG + Intronic
905337680 1:37256724-37256746 GAGGAGAGATGGAGAGAAGGAGG - Intergenic
905514547 1:38552564-38552586 TAGGAGAAATGGAGAAGAGACGG - Intergenic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
906484764 1:46225814-46225836 CAGTAGAATTAGAGAGATGTAGG - Intergenic
906885654 1:49644213-49644235 TAGTAACAATGGAGACAAGATGG + Intronic
907096578 1:51786900-51786922 TAGTATGAATGGAGAGAATAAGG - Intronic
907252853 1:53154313-53154335 GAGTAGAAATGGAAAGAAAATGG + Intergenic
907853767 1:58281428-58281450 TAGTGGAGATGGAGAGATATAGG - Intronic
907901565 1:58746303-58746325 TGGTGGACATGGAGAGAAGGGGG - Intergenic
908121643 1:60991525-60991547 TGGTAGAGCTGGTGAGAAGTAGG - Intronic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
909154371 1:72052993-72053015 TAATAGAAACAGAGAGTAGTAGG - Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909465317 1:75967295-75967317 TCGTGGTAATGGAGAGCAGTGGG - Intergenic
909761908 1:79299425-79299447 TGGAAGAAATGGAGAGATGTTGG - Intergenic
910064134 1:83132652-83132674 TGGTGGAAATGGATAAAAGTGGG - Intergenic
910089479 1:83445405-83445427 CAGTAAAAATGGAGAGGAGGAGG + Intergenic
910286425 1:85559874-85559896 TTGTCCACATGGAGAGAAGTAGG + Intronic
910576410 1:88769811-88769833 AAGAAGAAATGGGGAGAAGTTGG + Intronic
910606944 1:89097140-89097162 TGGGAGAAATGGAGAGATGATGG + Intergenic
910636016 1:89408750-89408772 TAGTAGGAGTGGAGAGGAGGAGG - Intergenic
911093573 1:94037423-94037445 AAGGGGAAGTGGAGAGAAGTAGG - Intronic
911114574 1:94233385-94233407 TGGTAGCAGTAGAGAGAAGTGGG - Intronic
911433430 1:97823471-97823493 GAGTGGAAATGGGGAGAGGTTGG - Intronic
911906553 1:103576385-103576407 TAGTAGAAATCATGATAAGTTGG - Intronic
911910061 1:103622760-103622782 TAGTAGAAATTAAAAGAAGTTGG - Intronic
911917477 1:103716885-103716907 TAGTAGAAATTAAAAGAAGTTGG - Intronic
912053975 1:105570969-105570991 TAGTGGAAATAGGGAGATGTTGG + Intergenic
912614140 1:111080030-111080052 TAGTGGAAAGGGGGAGAAGGAGG - Intergenic
912865467 1:113252410-113252432 AAGTGGTAATGGAGATAAGTGGG + Intergenic
913967118 1:143385488-143385510 TGGCAGAAAGGGAGAGAACTGGG + Intergenic
914061494 1:144211095-144211117 TGGCAGAAAGGGAGAGAACTGGG + Intergenic
914117656 1:144755274-144755296 TGGCAGAAAGGGAGAGAACTGGG - Intergenic
914191912 1:145419221-145419243 AAGTAGGGAAGGAGAGAAGTAGG + Intergenic
915688050 1:157656167-157656189 CAGCAGAAAAGGAGAGAAATTGG + Intergenic
915739480 1:158107689-158107711 AAGTAAGAATGGAGAGAAGGTGG - Intergenic
915925701 1:160017599-160017621 TACTAGAGATGGTAAGAAGTGGG - Intergenic
916900390 1:169215949-169215971 TGGAAGAAATGGAGAGATGATGG + Intronic
917063260 1:171063982-171064004 GAGGAGAGATGGAGAGAAGGGGG + Intronic
917161928 1:172067336-172067358 CAATGGAAATGGAGAAAAGTGGG - Intronic
917223832 1:172760697-172760719 TAGTAAAGAAAGAGAGAAGTGGG + Intergenic
917604032 1:176607344-176607366 AAGTAGATATGAAGAGAGGTAGG - Intronic
918297134 1:183167562-183167584 TAGTCCAAATGAAGAGAAATAGG + Intergenic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918492279 1:185094050-185094072 GAGTAAGAATGAAGAGAAGTAGG - Intronic
919168850 1:193928692-193928714 GAGCAGAAATGAAAAGAAGTGGG + Intergenic
919318969 1:196009641-196009663 TGGGGGAAATGGAGAGAGGTTGG + Intergenic
919428077 1:197458722-197458744 TAGTACACAGGGAGAGAAGAAGG + Intronic
919496329 1:198274126-198274148 TGGAAGAAATGGAGAGCAGCTGG + Intronic
919612058 1:199757803-199757825 TAGCAGGAATGGTGAGAAGAAGG - Intergenic
920979684 1:210821623-210821645 TAGAAGGAATGTGGAGAAGTGGG + Intronic
921323245 1:213964379-213964401 TAAGGGAAATGGAGAGATGTTGG + Intergenic
921384549 1:214555338-214555360 TTGGAGTAATGGAGAGAAGTGGG + Intergenic
922084101 1:222329044-222329066 TGGGAGAAATGGGGAGATGTAGG + Intergenic
922429748 1:225539214-225539236 CAGTAGCAATGGAGAGAGTTTGG - Intronic
922522715 1:226270433-226270455 TACTAGACATGTAAAGAAGTAGG + Intronic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
923310524 1:232730355-232730377 TGGTAGAAATGGAGAGAAGTAGG - Intergenic
923451190 1:234118939-234118961 TACTAAAAATGGAGCTAAGTTGG + Intronic
923455377 1:234161003-234161025 TCACAGAAATGGAGAGAAGCAGG - Intronic
923964515 1:239122390-239122412 TGGTAGGAATGAAGAGAAGCTGG + Intergenic
924263817 1:242259985-242260007 TACTAGATTTGGTGAGAAGTAGG + Intronic
924301886 1:242648029-242648051 TAGTAGGTATGGACAGAAATGGG + Intergenic
924349972 1:243105378-243105400 TGAGAGAAATGGAGAGAGGTTGG + Intergenic
1063675488 10:8137737-8137759 GAGAAGAAAAGGAGAGAAGCAGG + Intergenic
1063773766 10:9236268-9236290 TAATACAAATGCAGAAAAGTGGG - Intergenic
1063954767 10:11255735-11255757 TCCTAGAAATGGAGAGAAGGTGG - Intronic
1064406936 10:15072360-15072382 TAGTGTAAAAGGAGAGATGTTGG + Intronic
1064514833 10:16135749-16135771 GAGTAGAAATGGAGAGTAGAGGG + Intergenic
1064810247 10:19188855-19188877 CAGTAGAGATGGTCAGAAGTGGG + Intronic
1065480993 10:26193670-26193692 TAGAAGAAAAGGAAAGAAGAGGG + Intronic
1065575274 10:27111540-27111562 TAATCTAAATGTAGAGAAGTTGG - Exonic
1065986331 10:30956543-30956565 TAGGAGAGATGAAGAGAGGTTGG - Intronic
1066588822 10:36969665-36969687 TAGTAGAATGGGAGACAGGTTGG - Intergenic
1068379607 10:56234037-56234059 TAGTGGAAATGGAGATAACTGGG - Intergenic
1068461049 10:57329229-57329251 TGGTAGAAGTGTAGACAAGTAGG + Intergenic
1068815714 10:61309378-61309400 TAGGGGAAATGGTGAGATGTTGG - Intergenic
1068927394 10:62554456-62554478 GAGAAGAAAAGGAGAGAAGGTGG - Intronic
1069312624 10:67057406-67057428 TGAGAGAAATGGAGAGATGTTGG - Intronic
1069938636 10:71937710-71937732 TAGTTGAAATGGAGAGAAGTGGG - Intergenic
1070138699 10:73719722-73719744 TTGTAGAAACGGAGATAAGCCGG + Intergenic
1070429685 10:76324783-76324805 TATTAGTGATGGAGAGAAATTGG + Intronic
1070541805 10:77420817-77420839 AAGCTGAGATGGAGAGAAGTGGG - Intronic
1070715316 10:78716653-78716675 TAGGAGGAAAGGAGAGATGTGGG - Intergenic
1071199214 10:83199592-83199614 TAATAGAAACGGAGATAAATAGG + Intergenic
1073707133 10:105997621-105997643 CAGAAGAAATGAAGAGATGTTGG - Intergenic
1073846800 10:107566665-107566687 TAATAGAAATGGAGGTAAATAGG + Intergenic
1074052873 10:109895764-109895786 TATTAGAAATGGAGAGAAGTGGG - Intronic
1074554282 10:114474233-114474255 CAGTAGAGAGGGAGAGAAATGGG - Intronic
1074595282 10:114858730-114858752 GAGGAGGAATGGAGAGAAGTTGG + Intronic
1075857859 10:125645712-125645734 TATTAGCATTGGAGAAAAGTGGG + Intronic
1076617027 10:131761900-131761922 AAGAAGAAATGGAAAGAAGGAGG + Intergenic
1076963863 11:61803-61825 TAGTGGAAATAGAGATAAGGAGG + Intergenic
1078356318 11:10634534-10634556 TGGGAGAAATGGGGAGATGTTGG - Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1079188812 11:18260703-18260725 TAGTAAGACTGGAGAGAAGGTGG - Intergenic
1079218854 11:18540706-18540728 AACTAGAAATAGAGAGATGTAGG - Intronic
1079992027 11:27256270-27256292 CAGGAGAAAGAGAGAGAAGTAGG + Intergenic
1080075510 11:28142953-28142975 CAGTTTAAATGGAGAGAGGTGGG + Intronic
1080156995 11:29122953-29122975 TAGTAGGAATTTAGGGAAGTGGG - Intergenic
1080788524 11:35498716-35498738 TTTGAGAAATGGAGAGAAGGTGG - Intronic
1080935832 11:36862470-36862492 CAGAAGAGATGGAGAAAAGTGGG - Intergenic
1081167570 11:39824555-39824577 TATTATATATGGTGAGAAGTAGG - Intergenic
1081517092 11:43843631-43843653 GAGAAGAACTGGAGAGGAGTTGG - Intronic
1082733869 11:56834165-56834187 TAGAAAAAATGGGGAGATGTTGG - Intergenic
1083487016 11:62989651-62989673 AAGCAGCAATGGAGAGAAGGAGG + Intronic
1084138370 11:67205137-67205159 TAGCAAAAATGCAGAGAAATTGG - Intronic
1085014962 11:73167909-73167931 TAGGAGAGAGGGAGAGAAGTGGG + Intergenic
1085134358 11:74072320-74072342 TAGTATAAACGGGGAGGAGTAGG + Intronic
1086052953 11:82615636-82615658 TTGTTGAAATGGAGAAAACTAGG - Intergenic
1086101865 11:83109095-83109117 CAGTAGAGGTAGAGAGAAGTAGG + Intergenic
1086320115 11:85637177-85637199 TAGTATCAATGCAGAGAAATGGG - Intergenic
1087588853 11:100158242-100158264 TACTGGAAATGGAGAGTTGTTGG + Intronic
1087592964 11:100215684-100215706 AAGCAGAAATGAAGAGAAGCTGG + Intronic
1087631205 11:100652589-100652611 TAATAGAAGTGGTGAAAAGTGGG - Intergenic
1087788473 11:102382193-102382215 TAGTAGAAATGGAAAGACTATGG + Intergenic
1088137242 11:106571640-106571662 TACCAGCAATAGAGAGAAGTAGG + Intergenic
1088977751 11:114830817-114830839 TAGTAGAAATAGAGAGGAAATGG + Intergenic
1089313534 11:117575331-117575353 TAGAAGAAATGGGGTGAGGTAGG + Intronic
1089547620 11:119241842-119241864 GTGTAGAGATGGAAAGAAGTGGG + Intronic
1089633113 11:119795842-119795864 TTCTAGAAATGCAGAGAAGGAGG + Intergenic
1089768651 11:120786621-120786643 CAGTTGAAATGAAGAGATGTTGG - Intronic
1090096542 11:123747295-123747317 TAGTAGATATGGAGGGCATTGGG + Intergenic
1090309527 11:125722739-125722761 AAGTAGAAAGGAAGGGAAGTGGG - Intergenic
1090644830 11:128758873-128758895 TTGTAGAAATGGAGACAGGAGGG + Intronic
1090808172 11:130215885-130215907 GAGGAGAAAAGGAGAGAAATAGG - Intergenic
1091257294 11:134200585-134200607 TGGTAGGAATGCAGAGAAATAGG + Intronic
1092028215 12:5261057-5261079 AAGCAGAAGTGGAGAGAAGAGGG + Intergenic
1092352870 12:7770058-7770080 AAGCAGAAATGGAGAGAAGAAGG + Exonic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1092620770 12:10264838-10264860 TAGAAGAAATGGAGAGATATCGG - Intergenic
1092665026 12:10786641-10786663 TAGAAGAAATGAAGAGATATTGG - Intergenic
1092882603 12:12899390-12899412 TGGTTTAAATGGAGAGAGGTTGG + Intronic
1093262571 12:16957349-16957371 TATGAGAGAAGGAGAGAAGTGGG - Intergenic
1093820331 12:23609047-23609069 TAGAAGAAATGGAGTTAAGGTGG + Intronic
1094484002 12:30909555-30909577 TAGAATAAATTGAGAGCAGTAGG - Intergenic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1094664923 12:32510194-32510216 TAGTGGGAATGGGAAGAAGTGGG + Intronic
1095319613 12:40810523-40810545 TGGTGGAAATGGGGAGATGTTGG - Intronic
1096056344 12:48655608-48655630 AAGTAGAAACGGAGAATAGTAGG + Intronic
1096440367 12:51637601-51637623 TCATAGAATTGGAGAGAATTAGG - Intronic
1096750774 12:53757464-53757486 TAGGAGAAAAGGAGAAAAGCCGG - Intergenic
1096884926 12:54708277-54708299 TGGGAGAAATGGGGAGATGTTGG - Intergenic
1097397849 12:59097762-59097784 AAGGAGAAAGGGAGAGAAGGAGG + Intergenic
1097452018 12:59748138-59748160 TGGTAGAAGTGGAGAGGCGTGGG + Intronic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1098786734 12:74767830-74767852 TGGGAGAAATGGGGAGATGTTGG + Intergenic
1099039959 12:77640409-77640431 GGATGGAAATGGAGAGAAGTAGG - Intergenic
1099048762 12:77757423-77757445 TTGTAGAATTAGAGAGAAGAAGG - Intergenic
1099645526 12:85349138-85349160 TAGAAAATATAGAGAGAAGTGGG + Intergenic
1099828522 12:87810774-87810796 TTGTAGAAATGAAGAAAAGGAGG - Intergenic
1100279999 12:93109256-93109278 TAGAAAAAATGTAGAGAAGAAGG + Intergenic
1100312393 12:93408601-93408623 AATTAGATATGGAGAGAGGTGGG + Exonic
1100497283 12:95137810-95137832 CAGTGGAAATGGTGAAAAGTAGG - Intronic
1100631276 12:96391737-96391759 TAGTGAAAATGGAGAGAAAAGGG - Intronic
1101199263 12:102417716-102417738 TAGAGGAAATGAAGAAAAGTAGG - Exonic
1103010602 12:117455586-117455608 TGGAAAAAATGGAGAAAAGTGGG - Exonic
1103049109 12:117763852-117763874 CAGCAAAGATGGAGAGAAGTCGG + Intronic
1103099298 12:118158597-118158619 TAATGGAGATGGAGAGGAGTGGG - Intronic
1103245701 12:119455249-119455271 TGGGAGCAATAGAGAGAAGTAGG + Intronic
1104001960 12:124865551-124865573 AAGAAAAAAGGGAGAGAAGTGGG + Intronic
1104489443 12:129181325-129181347 AAGTAGAGATGGAGAGAAGGAGG - Intronic
1104823111 12:131689686-131689708 TAGTAGAAATGGAGTGTCTTAGG - Intergenic
1105042652 12:132972698-132972720 AAGCAGAAATGGAGAGGAGGAGG - Intergenic
1105656345 13:22443967-22443989 TGGGAGAAATGGGGAGAAGTTGG - Intergenic
1105732693 13:23234485-23234507 TAGGAGAAATGCAGAAAAGGTGG + Intronic
1106471705 13:30061743-30061765 AAGAAAAAATGGAGAGAAGAGGG - Intergenic
1106527935 13:30559730-30559752 TAGTAGTTATGGAGAGACTTGGG - Intronic
1106541455 13:30694200-30694222 GAATAGAAATGGTGAAAAGTGGG + Intergenic
1106608842 13:31258416-31258438 TATTAAATATGGAGAGAAGATGG - Intronic
1107187437 13:37540577-37540599 TATTACAAATGGAGAGAAATTGG + Intergenic
1107317542 13:39149995-39150017 AAGTAGAGAAGGAAAGAAGTCGG + Intergenic
1108240078 13:48455094-48455116 AAATAGAAATGGAGAGATCTGGG + Intronic
1108859207 13:54832895-54832917 TAGTATTAATAGAGAGAAATAGG - Intergenic
1108911976 13:55565645-55565667 AAGTAGGAATGCAGATAAGTAGG + Intergenic
1108941531 13:55962033-55962055 TATTAGAGAGGGAGAGAAGGAGG + Intergenic
1109015605 13:57008763-57008785 GAGGAGAAATGCAGAGATGTTGG + Intergenic
1109103362 13:58215405-58215427 AGGAAAAAATGGAGAGAAGTGGG + Intergenic
1109889617 13:68591633-68591655 TAGTAGGGATGCAGAGAAATAGG - Intergenic
1110009274 13:70311386-70311408 GAGTGTCAATGGAGAGAAGTTGG - Intergenic
1110119863 13:71866900-71866922 AAGGAGAAAGGGAGAGAAGGGGG + Intronic
1110783736 13:79497983-79498005 TAGTGGCACTGAAGAGAAGTGGG + Intronic
1110872773 13:80471820-80471842 AAGAAGGAATGGAGAGCAGTGGG - Intergenic
1111359769 13:87160964-87160986 TGGGAGAAAGGGAGAGAAGAGGG + Intergenic
1111401851 13:87747938-87747960 TAATAGAATTGAAGAGATGTAGG - Intergenic
1111723782 13:91978875-91978897 CAGTAGAAATGAAGAGGACTTGG + Intronic
1112273035 13:97987673-97987695 TAGTAGAGATGGAGCCAACTGGG + Intronic
1112671169 13:101640773-101640795 TACTAGAAAGGGAGAGAGGGAGG - Intronic
1112834700 13:103500109-103500131 CAAAAGAAATGGAGAGAAATGGG + Intergenic
1113024191 13:105922211-105922233 AAGAAGAAATGGAGGGAAGAGGG - Intergenic
1114238741 14:20846646-20846668 TGGTAGAAAGGAAGGGAAGTAGG + Intergenic
1114523649 14:23354125-23354147 TGGTAGAGATGGAGAGATGTGGG - Intergenic
1114620190 14:24091441-24091463 TAGGAGAAAAGGAGGCAAGTGGG + Intronic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115141746 14:30179614-30179636 GAGGAGAGATGGAGAGAACTAGG + Intronic
1115891519 14:38035019-38035041 TGATAGAATTGAAGAGAAGTAGG + Intronic
1115920736 14:38370335-38370357 AGGGAGAAATGGGGAGAAGTTGG + Intergenic
1116132536 14:40875100-40875122 TGGCAGAAATGTGGAGAAGTTGG + Intergenic
1117760309 14:59020017-59020039 TGGTAGAAATGGGGAGATGTTGG + Intergenic
1118151773 14:63197257-63197279 CAGTAGCCATGGACAGAAGTAGG - Intergenic
1118906165 14:70024972-70024994 TAAGGGGAATGGAGAGAAGTGGG + Intronic
1119402218 14:74370661-74370683 TGGTGGAAGTGGAGAGAAGTAGG - Intergenic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1119994649 14:79240009-79240031 TAGGGGGAATGGAGAGATGTTGG + Intronic
1121971296 14:98358845-98358867 CAGTAGAAATGGAGAAAGGGTGG - Intergenic
1123510393 15:20992903-20992925 AGGTAGAAATGGAGAGATGATGG - Intergenic
1123567608 15:21566652-21566674 AGGTAGAAATGGAGAGATGATGG - Intergenic
1123603869 15:22003945-22003967 AGGTAGAAATGGAGAGATGATGG - Intergenic
1124292153 15:28463139-28463161 CAGTGGAAAAGGAGAGAACTTGG + Intergenic
1125017498 15:34950552-34950574 TACTAAAAATGGATAGACGTGGG - Intronic
1125100052 15:35902115-35902137 TGGTAGAAATGGAGATAAATGGG + Intergenic
1125457768 15:39878267-39878289 TGGGAGAAATGGGGAGATGTTGG - Intronic
1125615494 15:41008425-41008447 TAGGGGAAATGGGGAGATGTTGG + Intronic
1125803437 15:42471280-42471302 TACTGGAAATGCAGAGAACTGGG - Intronic
1125841503 15:42805608-42805630 TAATAGAGATGGAGGGAAATGGG - Intronic
1125890681 15:43264142-43264164 TAGTGGGAATGCAGAGAAATTGG + Intronic
1125969702 15:43901888-43901910 TGGTAGAAATGAAGAGAGGAGGG - Intronic
1126299964 15:47184428-47184450 GAGGAGAAATGGAGAGAAAAGGG - Intronic
1126973737 15:54150086-54150108 TAGTAAAAAGAGAGAGAAATAGG - Intronic
1127038089 15:54941932-54941954 TGGTAGAGGTGGAGAGAAGAGGG - Intergenic
1127169301 15:56282707-56282729 TAGTTGAAAGGGAGAAAAGTGGG + Intronic
1128282316 15:66406639-66406661 GATTAAAAATGGAGAGAAATTGG + Intronic
1128442703 15:67727492-67727514 AAGTATAAATGGAGGGTAGTAGG - Intronic
1128643003 15:69353692-69353714 GGGTAGAAATGGAGGGAGGTGGG + Intronic
1128757228 15:70191335-70191357 TGAAAGAAAAGGAGAGAAGTTGG - Intergenic
1128763855 15:70238672-70238694 AAGTAGAAATGAACAGAGGTTGG - Intergenic
1129935856 15:79449803-79449825 TGGTAGGGATGGAGAGAAGGAGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131515862 15:93076257-93076279 GAGTGGAAAGGGAGAGAAGGTGG - Intronic
1131805682 15:96119845-96119867 TAGTAGAAAAGAAGAAAAGAAGG - Intergenic
1132444687 15:101903368-101903390 TAGTGGAAATAGAGATAAGGAGG - Intergenic
1202975971 15_KI270727v1_random:293747-293769 AGGTAGAAATGGAGAGATGATGG - Intergenic
1132991810 16:2799262-2799284 TAGCAGAAAAGGAGAGAGGGCGG - Intergenic
1133876047 16:9735598-9735620 TGGTAGAAATGGAATGCAGTGGG + Intergenic
1133876920 16:9743735-9743757 TAGTGGAAATGAAGAGCAGCAGG + Intergenic
1135497691 16:22966780-22966802 TAGTTGAAATGGGGAGTTGTGGG - Intergenic
1137306581 16:47206777-47206799 TAGCAGTGATGGAGAGAAATGGG - Intronic
1138254826 16:55546846-55546868 TATTAGAAATTGAGAGAACTGGG + Intronic
1138361229 16:56429398-56429420 TCGTAAAAATAGAGATAAGTTGG - Exonic
1138900547 16:61264189-61264211 GAGAAGAAAGGGAGAGAGGTGGG + Intergenic
1139197029 16:64931182-64931204 GGGTGGAAATGGGGAGAAGTAGG + Intergenic
1140967468 16:79980746-79980768 TAGGAAAAATGGGGAGATGTAGG + Intergenic
1141816787 16:86416002-86416024 TAATAGAAATGGAGACCGGTGGG + Intergenic
1143179532 17:4975441-4975463 AAGAAGAAATGGAAAGAAGAGGG + Intronic
1143352167 17:6296999-6297021 TAGTAGAGATGGGGAGGAGGTGG - Intergenic
1143702091 17:8668232-8668254 TGGGAGAAATGGAGAGAAGATGG - Intergenic
1144051617 17:11501857-11501879 TAGTGGAAAAGGAGAGAAAAGGG + Intronic
1144211202 17:13017291-13017313 TAGCAGAGGTGGAGAGGAGTGGG + Intronic
1144342561 17:14322195-14322217 TCTTAGAAATGTAGAGAAGTGGG + Intronic
1144678282 17:17175659-17175681 TAGCAGAAATGGAGGGGAGTGGG - Intronic
1146491519 17:33286639-33286661 AAGTAGAAAAGGAGAGAAAGAGG - Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1147062013 17:37887596-37887618 TAGTGGAGATGGAGAGAGATAGG - Intergenic
1147328066 17:39679504-39679526 TAGTAGAGGTGGGGACAAGTGGG + Intronic
1147685980 17:42287265-42287287 GAGTGGAAATGGAGAGAAAAGGG + Intergenic
1148572227 17:48679155-48679177 TGGTAGAAATGGATAGACCTGGG - Intergenic
1148702816 17:49600524-49600546 TAGGAGAAATGTGGAGAAATGGG + Intronic
1148760929 17:49999636-49999658 GGGTAGAAGTGGAGAGCAGTGGG + Intergenic
1148974365 17:51513979-51514001 AAGCAAAAATGGAGAGAAGGTGG - Intergenic
1149242040 17:54662485-54662507 CTGGAGAAATGGACAGAAGTAGG - Intergenic
1149395619 17:56239243-56239265 CATAAGAAATGGAGAGAGGTTGG + Intronic
1149406546 17:56357507-56357529 CAGTAGAAAGGGAGAGATGCAGG - Intronic
1149688253 17:58551433-58551455 CAATAGAAATGGAAAGAAATGGG + Intergenic
1149916961 17:60619026-60619048 TAGGAGAAGTGGGGAGATGTTGG - Intronic
1149986617 17:61352532-61352554 GAGTAGAAGTGGAGGGAAGGAGG + Intronic
1150179124 17:63096428-63096450 TTGAAGAAATGGAGAGAACATGG + Intronic
1150506822 17:65707315-65707337 TACTAGAGATGGAGAGAAGTGGG - Intronic
1150937858 17:69657006-69657028 TATTAGGAATAGAGAGAAATAGG - Intergenic
1151426253 17:74032799-74032821 TGGTTGAACTGGAGGGAAGTCGG - Intergenic
1151999859 17:77638462-77638484 TAGGAGAGACGGAAAGAAGTGGG + Intergenic
1152936769 17:83143255-83143277 TAGTAAAAATGGCTAGAAGTTGG + Intergenic
1153082149 18:1239793-1239815 TAGAAGAAATGGTGAGAAAAAGG - Intergenic
1153539840 18:6141682-6141704 TAGTAGTGATGAAGATAAGTTGG - Intronic
1153540781 18:6151873-6151895 TAACAGAAATGGAGAAATGTTGG - Intronic
1153648402 18:7216227-7216249 TAGGAGGAATGGGGAGAGGTTGG - Intergenic
1154315946 18:13303474-13303496 AAGGAGAAAAGGAGAGAAGGAGG - Intronic
1155351117 18:24907241-24907263 CAGTACAGGTGGAGAGAAGTAGG - Intergenic
1155576040 18:27248047-27248069 CAGTGGAAGTGGGGAGAAGTGGG - Intergenic
1155891188 18:31271257-31271279 TATTAAAAATGTAGAGCAGTTGG - Intergenic
1156050290 18:32924528-32924550 TGGGAGAAATGGGGAGATGTTGG - Intergenic
1156875920 18:42011488-42011510 TTATAGAAATGGAGAGAATTAGG + Intronic
1157009773 18:43633193-43633215 CAGTAAAAATGGAGAGAAAAGGG - Intergenic
1157514682 18:48302371-48302393 CAGTAAAAAGGGAGAGAAGGTGG - Intronic
1157726886 18:49971250-49971272 GAGTAGAGAGGGCGAGAAGTGGG + Intronic
1157953810 18:52071862-52071884 TCATAGAGATGGAGAGTAGTAGG - Intergenic
1158225425 18:55196455-55196477 TAATAGAATTAGAGAGAAGTGGG + Intergenic
1158403870 18:57144201-57144223 TATCAGAAGTGGAGAGAAGTGGG + Intergenic
1158674659 18:59507291-59507313 TTGTAGAAATGGAGAGACATAGG - Intronic
1158683059 18:59586265-59586287 TGGTTGAAATGGAAAGAAGAGGG - Intronic
1160640667 19:131435-131457 TAGTGGAAATAGAGATAAGGAGG + Intergenic
1161463867 19:4416326-4416348 TAGTAGAAGTGAAGAGCAATGGG - Intronic
1161853079 19:6748492-6748514 TATTAGAACTGGAATGAAGTTGG + Intronic
1161880188 19:6944416-6944438 AGGGAGAAATGGAGAGAAGTAGG + Intergenic
1162746721 19:12802660-12802682 AAGGAGAAATGGAAAGAGGTCGG + Intronic
1164772034 19:30816611-30816633 AAGAAGAAATGGAGGGAGGTAGG - Intergenic
1166239895 19:41483141-41483163 TTGTAGAAATAGTGAGAAATAGG - Intergenic
1166914120 19:46182959-46182981 TGGGAGAGATGGGGAGAAGTGGG - Intergenic
1168125654 19:54281099-54281121 GAGGAGAAATGCAGGGAAGTAGG + Exonic
1202700901 1_KI270712v1_random:162983-163005 TGGCAGAAAGGGAGAGAACTGGG + Intergenic
926604640 2:14885251-14885273 GAGTAGAGATGGAGAGAAATGGG + Intergenic
926974011 2:18495306-18495328 AAGGAGAAAAGGAGAGAAATAGG - Intergenic
926999921 2:18783904-18783926 TATTAGGAATTGAGTGAAGTAGG + Intergenic
927134460 2:20086625-20086647 TGGTAGTAAGGGACAGAAGTTGG - Intergenic
927310321 2:21623594-21623616 TAGAAGATACGGGGAGAAGTGGG + Intergenic
927636050 2:24817764-24817786 TACAAGAAAAGGAGAAAAGTTGG + Exonic
927644401 2:24867652-24867674 AATCAGAAATGGAGAGAATTTGG + Intronic
928389304 2:30897118-30897140 TAGGAGACATGGAAAAAAGTGGG - Intergenic
928633963 2:33223676-33223698 TAGTAGAAATGGAATGAACAGGG + Intronic
928709938 2:33992685-33992707 TAGTAGGAATGTAGAGAATAGGG + Intergenic
928814007 2:35267545-35267567 CAGGGGAAAGGGAGAGAAGTTGG - Intergenic
928866472 2:35922804-35922826 TAGTGGAAAGGAAGAGAAGAAGG + Intergenic
929556264 2:42927438-42927460 TAGTAGAAATGGGAACAAGTAGG + Intergenic
930721616 2:54643638-54643660 AAGTCTAAAAGGAGAGAAGTCGG - Intronic
931166059 2:59749876-59749898 TAGTAGAAAGGCAGCTAAGTAGG - Intergenic
931807361 2:65820172-65820194 TAGTAGAGGTGGAGAGAAGCAGG - Intergenic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
931865705 2:66408739-66408761 TTATAGAAATGGAGCTAAGTTGG - Intergenic
931952270 2:67378408-67378430 TAGAAGAAATGGACAGAAATAGG + Intergenic
932294251 2:70610914-70610936 TAGTGGAAATGGATAGTATTTGG + Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932833871 2:75016564-75016586 TGGGAGAAATGCAGAGATGTTGG + Intergenic
933487388 2:82939800-82939822 TAATAGAATTGAAGAGAATTGGG + Intergenic
934171828 2:89546472-89546494 TGGCAGAAAGGGAGAGAACTGGG + Intergenic
934282136 2:91620790-91620812 TGGCAGAAAGGGAGAGAACTGGG + Intergenic
935015465 2:99177829-99177851 TAGGAGGAATGGGGAGAGGTTGG - Intronic
935177236 2:100660290-100660312 AAGCAGAAATGGAGAGAAGGAGG + Intergenic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937043735 2:118839766-118839788 AAGGAAAAATGGAGAGAAGATGG + Intergenic
937539895 2:122936359-122936381 GAGAAGAAATGGACAGAAGAGGG + Intergenic
937627902 2:124064446-124064468 TAATAGAAATGGAGAGAAGCAGG - Intronic
938214186 2:129494711-129494733 TGGTAGAAATGGGGAGATGTTGG - Intergenic
938316307 2:130331713-130331735 AAGTAGAAATGAAGAAATGTGGG - Intergenic
939377192 2:141383854-141383876 TACAAGAAATGGAGAGACATTGG + Intronic
939786237 2:146516692-146516714 CAGTAGAGATGGAGATAAGCGGG + Intergenic
939835386 2:147124138-147124160 GAGTAGAGAAGGAGAGAAATGGG + Intergenic
939859550 2:147401718-147401740 TAGCAGAAATGCAGAGTAGGAGG - Intergenic
940382008 2:153025699-153025721 CAGCAGATATAGAGAGAAGTGGG - Intergenic
940683353 2:156814427-156814449 TACTAGAACTGGGAAGAAGTAGG + Intergenic
941118411 2:161498952-161498974 TGGGAGAAATGGGGAGATGTTGG - Intronic
941565550 2:167101466-167101488 TGGGAGAAATGGTGGGAAGTGGG - Intronic
941839834 2:170069577-170069599 TGGGAGAAATGGGGAGATGTTGG - Intronic
941899512 2:170664612-170664634 CAGCAGAAATGGCCAGAAGTAGG + Intergenic
942175368 2:173328707-173328729 AAGAATAAATGGAGAGAAATTGG - Intergenic
942813724 2:180026607-180026629 AAGGAGAAATAGAGTGAAGTGGG + Intergenic
942822342 2:180129473-180129495 TTGTAGAATTGAAGAGAAATAGG + Intergenic
943804745 2:192110543-192110565 TAGAAGAAATAGAAAGAATTGGG - Intronic
944903547 2:204240070-204240092 TATTTGAAAAGGAGAGGAGTTGG + Intergenic
945020502 2:205566392-205566414 AAGCAGAATCGGAGAGAAGTGGG + Intronic
945519966 2:210814211-210814233 CAGGAGCAATGGAGAGAAGTAGG + Intergenic
945531215 2:210955579-210955601 GAGTAGAAAGGGAGAGAGATTGG - Intergenic
946826268 2:223681400-223681422 TAGCAAAAATGTAGAGAAATTGG + Intergenic
946915127 2:224511388-224511410 TAGTAGAAATGGAGAATTCTGGG - Exonic
946920315 2:224573942-224573964 TAGTGGAAATGGAAAGGAATTGG + Intronic
946970209 2:225082474-225082496 AAGAAGGAAGGGAGAGAAGTGGG + Intergenic
947076697 2:226352774-226352796 TGGTAGAACTGGACAGAACTGGG - Intergenic
947289549 2:228557207-228557229 TGGTGGAAATGGAAAGAAGAGGG - Intergenic
947791562 2:232872012-232872034 TAGGACACATGGAGGGAAGTGGG - Intronic
947888876 2:233597926-233597948 TATTAGTAAGGAAGAGAAGTGGG - Intergenic
948100408 2:235368446-235368468 CAGTAGCAAAGGAGACAAGTTGG + Intergenic
1169113687 20:3048946-3048968 TGGGAGACATGGAGAGAAGCTGG - Intergenic
1169215410 20:3791216-3791238 TAAGAGAAATGCTGAGAAGTGGG + Intronic
1169365229 20:4986696-4986718 GAATATAAATAGAGAGAAGTGGG + Intronic
1169688108 20:8299827-8299849 AAGTGAAAATGGAGAGAAGTGGG - Intronic
1169776461 20:9259582-9259604 TGGCAGAGATGGAGAGAAGGAGG + Intronic
1169907385 20:10617477-10617499 TGGGAGATAGGGAGAGAAGTTGG - Intronic
1170545664 20:17433898-17433920 GAGAGGAAAGGGAGAGAAGTAGG - Intronic
1170851365 20:20007514-20007536 TTGTAGAAGTGGTGAGAAATCGG - Intergenic
1171077179 20:22139732-22139754 TTGCAGAGATGTAGAGAAGTTGG - Intergenic
1173117244 20:40256841-40256863 CAGCAGAAATGGATAGCAGTAGG + Intergenic
1173149260 20:40551540-40551562 AAGGAGAAAGGGAGAGAAGGAGG + Intergenic
1174530028 20:51204267-51204289 TTGAAGGAATGCAGAGAAGTAGG - Intergenic
1174747554 20:53078709-53078731 CAATAGAGATGTAGAGAAGTGGG + Intronic
1177308955 21:19361662-19361684 TAGTCCAAATGGGCAGAAGTTGG + Intergenic
1177601621 21:23322683-23322705 TACTAGAAAGGGGGAGATGTAGG - Intergenic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1177758154 21:25372388-25372410 TAGAAGAAATGGACAGACATAGG + Intergenic
1177774347 21:25551272-25551294 CAGTAGAGATGGACAGATGTAGG + Intergenic
1178084397 21:29098312-29098334 CAGTAGAAAAAAAGAGAAGTGGG - Intronic
1178231407 21:30789196-30789218 TAGAGGAAATGGGGAGAAGTAGG - Intergenic
1178799251 21:35777188-35777210 TGATAGAAAGGGAGAGAAGACGG - Intronic
1180932545 22:19602819-19602841 TCATAGAATTGAAGAGAAGTAGG + Intergenic
1181504208 22:23340468-23340490 AAGAAGAAAAGGAAAGAAGTGGG + Intergenic
1181655318 22:24293080-24293102 AAGAAGAAAAGGAAAGAAGTGGG + Intronic
1181709201 22:24670704-24670726 AAGAAGAAAAGGAAAGAAGTGGG + Intergenic
1182710837 22:32322287-32322309 TGGTAGAAATGGCCAGAAGCAGG + Intergenic
1182714339 22:32343475-32343497 TTTAAGAAATGGAGAAAAGTAGG + Intergenic
1182817953 22:33183854-33183876 TAGAAGAAATGGAGAGATGTTGG + Intronic
1182983171 22:34691755-34691777 AAAGGGAAATGGAGAGAAGTAGG - Intergenic
949429083 3:3953607-3953629 GAGGAGAAATGGGGAGATGTAGG - Intronic
949723548 3:7018329-7018351 GAGTAGAATTACAGAGAAGTGGG + Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
951074654 3:18375231-18375253 TAGGAGAAATGCAGAGAATTTGG + Intronic
951479405 3:23143555-23143577 TAGTAAAAACGAATAGAAGTAGG - Intergenic
951564668 3:24001415-24001437 TACTAGACATGCAAAGAAGTAGG - Intergenic
952214045 3:31258298-31258320 TTGGAGAAATGGAGAGATGTTGG - Intergenic
952402455 3:32975578-32975600 TAGTAGAAAAGGAGAGAAAGAGG + Intergenic
952579495 3:34815699-34815721 TTGTAGAAATGGGGAAATGTTGG - Intergenic
952676665 3:36039590-36039612 TAGTAAAAGTGGAGAAAAGGAGG - Intergenic
953237811 3:41121402-41121424 AAGTGGAAATGGAGAGGGGTTGG + Intergenic
953279437 3:41539461-41539483 TAGTAGTGTTGGAGAGTAGTAGG - Intronic
954908509 3:54083688-54083710 TCTTAGAAATGGAGAGAAATAGG + Intergenic
955098577 3:55824261-55824283 TGGTAGAAATGGAGAGAGCCTGG - Intronic
955311231 3:57888804-57888826 TTTTAGGAATGGAGTGAAGTAGG + Intronic
955521236 3:59777552-59777574 TAGTGGAGGTGGAGAGAAATAGG - Intronic
955674151 3:61432989-61433011 GGGTAGAAAGGGAGAGTAGTTGG - Intergenic
955741539 3:62096073-62096095 GAGTTGAGCTGGAGAGAAGTAGG + Intronic
956164976 3:66391169-66391191 TAGCAAAAATGGGGAGAAATTGG + Intronic
956335615 3:68160075-68160097 TAGTAGAAATGGAAAGCTCTTGG + Intronic
956861458 3:73327924-73327946 TTGTAGAAATAGAGAGGAGGAGG - Intergenic
957271443 3:78035614-78035636 TGGAAGAAATGGGGAGAAGAGGG - Intergenic
957542532 3:81592276-81592298 TGGAGGAAATGGAGAGATGTTGG - Intronic
957574783 3:81993164-81993186 TGTGAGAAATGGAGAGATGTTGG + Intergenic
958164641 3:89864262-89864284 TAGTAGGTTTGGAAAGAAGTAGG - Intergenic
959397197 3:105855263-105855285 GGGAAGAAATGGAGAGAAGAAGG + Intronic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
960078302 3:113513710-113513732 TAGTAGAGATGGAGAAGAGCGGG - Intronic
960537036 3:118826034-118826056 TGGTGGAAATGGAGAGAAGGAGG + Intergenic
960677165 3:120206696-120206718 TGACAGAAATGGAGAGATGTTGG - Intronic
960767925 3:121158032-121158054 TGGCAGAAATGGAAACAAGTGGG - Intronic
960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG + Intronic
961369603 3:126421507-126421529 AAGCAGGGATGGAGAGAAGTGGG + Intronic
961596703 3:128023360-128023382 TGTTAGAAATGGAAAGAAATAGG - Intergenic
961672039 3:128540216-128540238 CAGTAGGAATGGAAAGAATTGGG + Intergenic
962643057 3:137408204-137408226 TGGTAGAAATGGAGGGAAAAAGG + Intergenic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963195258 3:142520624-142520646 TCATAGAATTGGAGAGAACTAGG - Intronic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
964007635 3:151851255-151851277 ATGGAGAAATGGACAGAAGTAGG - Intergenic
965220670 3:165922539-165922561 TAGCAGAAATGGAAAAAAATGGG + Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
965382509 3:168007313-168007335 TAGTGAGTATGGAGAGAAGTGGG + Intergenic
965440162 3:168702638-168702660 CAGAAGAAATAGAGAGATGTGGG - Intergenic
965493705 3:169371358-169371380 TAGGGGAAATGGGGAGATGTTGG + Intronic
965773439 3:172204980-172205002 TAGTGGAAATGGAGAGAGACGGG + Intronic
966008103 3:175042062-175042084 TGGGAGAAATGGAGAAAAGTTGG - Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966547064 3:181161179-181161201 TAGGAAAAATGAAGAGATGTTGG - Intergenic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967926978 3:194658094-194658116 TCGTAGAGATGGAGAGACTTAGG - Intronic
969996895 4:11322639-11322661 TGGGAGAAATGGAGAGATATTGG + Intergenic
970105318 4:12575992-12576014 TAGTGGAAAAGGAGAGAAAAGGG + Intergenic
970573361 4:17404297-17404319 AAGGAGAAAGGGAGAGAAGGAGG + Intergenic
970693236 4:18643987-18644009 TGGTGGAAATATAGAGAAGTTGG - Intergenic
970787177 4:19813322-19813344 TGAAAGAAATGGATAGAAGTGGG - Intergenic
970934005 4:21546980-21547002 TGGTAGAAAGGAAGAGAAATTGG - Intronic
971236686 4:24848892-24848914 TAGAAGACATGAAGAGAAATGGG + Intronic
971251877 4:24979424-24979446 GAGAAGACATGGAGAGAAGTGGG + Intronic
972263152 4:37431521-37431543 TAGAGGAAATAGAGAGATGTTGG + Intronic
972393335 4:38634052-38634074 GAGTGGAAATGAAGAGAAATGGG - Intergenic
973364010 4:49192616-49192638 TAAAAGAAAGAGAGAGAAGTTGG - Intergenic
973397072 4:49604127-49604149 TAAAAGAAAGAGAGAGAAGTTGG + Intergenic
973716563 4:53682708-53682730 TGGTAAAAATGGTGAGAAGTGGG - Intronic
973756773 4:54082523-54082545 TAATAGAAATAGAGTGGAGTAGG - Intronic
974439619 4:61899322-61899344 TTGCAGAAATGGAAAGAGGTAGG - Intronic
974671633 4:65037351-65037373 AAGTAGATCTGGAGAGACGTTGG - Intergenic
974732488 4:65886628-65886650 TAGTGGAAATTGAGAGAATCTGG - Intergenic
974776433 4:66488877-66488899 TAGGAGAAATGGGGAGATTTTGG + Intergenic
974801147 4:66819714-66819736 TGGGATAAATGGAGAGACGTTGG + Intergenic
974831257 4:67192431-67192453 CAGTAGAAATGGAGAGATAAAGG - Intergenic
975275144 4:72488965-72488987 TTATAGAAATGGAGAGTAGAAGG - Intronic
975479796 4:74865306-74865328 TAGCAAAAATGCAGAGAAATAGG + Intergenic
975823332 4:78293761-78293783 CAGAAAAAATGGAGAGAAGAGGG + Intronic
976033362 4:80785542-80785564 TAGTAGAAATTGTGAAAATTTGG + Intronic
976622066 4:87138687-87138709 TAGTAGCAGTGGTGAGGAGTGGG + Exonic
977505013 4:97890544-97890566 TAATAAAACTGAAGAGAAGTTGG + Intronic
977969887 4:103200950-103200972 TTGTGGCAATGGAGAGAGGTAGG + Intergenic
978036832 4:104005143-104005165 TAGGAGAAATGGAGATACGGTGG + Intergenic
978105574 4:104898132-104898154 TAATAGAAATGTAGAGGAGTGGG + Intergenic
978435109 4:108675922-108675944 TAGGAGAATTGGGGAGATGTTGG - Intergenic
978465318 4:109002544-109002566 TGGCAGAAATGGGGAGATGTTGG + Intronic
978845938 4:113272579-113272601 TAGCAAAAATGGAAAAAAGTAGG + Intronic
979043809 4:115835391-115835413 TTGTACAAATTGACAGAAGTAGG + Intergenic
979251969 4:118575165-118575187 TGAGAGAAATGGAGAGAGGTTGG - Intergenic
979880966 4:125960341-125960363 TGGGGGAAATGGAGAGATGTTGG - Intergenic
979995156 4:127423551-127423573 TAGTGGAAATGAAGAGAAATAGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980953284 4:139402927-139402949 ACATGGAAATGGAGAGAAGTTGG - Intronic
981595169 4:146412742-146412764 GAGGAGAAATGGGGAGCAGTTGG + Intronic
981907267 4:149935928-149935950 TAGGGGAAATGGGGAGATGTTGG - Intergenic
982159473 4:152553425-152553447 TAGAAGAAATGAAGAGAGGTAGG + Intergenic
982460201 4:155660448-155660470 TTGTAGAAAAGGAGGGAAGAAGG - Intergenic
982808658 4:159798911-159798933 TATTAAAAATGGAGAGAAATAGG - Intergenic
982974512 4:162037110-162037132 TGGTAGAAATTGAGAGGATTAGG + Intronic
983037722 4:162887888-162887910 TATTAAAAATGGAGAGACTTGGG + Intergenic
983827200 4:172278152-172278174 AAGTAGAAATGTGGAGAAATGGG - Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984085502 4:175305811-175305833 TAGAAGAAATGGAAAGAAGTAGG + Intergenic
984090099 4:175362735-175362757 TAATAAAAATGAAGAGAAGCTGG + Intergenic
984537590 4:180996222-180996244 AAGGAGAAATGGAGAGATGTTGG - Intergenic
984579024 4:181488305-181488327 CAGTACAATTGGTGAGAAGTCGG + Intergenic
984675125 4:182538698-182538720 TAGTGGAGTTGAAGAGAAGTGGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985069408 4:186153182-186153204 TGATAGAAATGGAGGGAAGGTGG + Intronic
985420828 4:189783770-189783792 GAGAAGAAAGGGAGAGAAGGAGG + Intergenic
986889476 5:12284012-12284034 TAGAAAAAATGGAGAGTAGGTGG - Intergenic
986927547 5:12775378-12775400 TGGGAGAAATAGAGAGATGTTGG + Intergenic
986928545 5:12790347-12790369 GAGTAGAAATAGAGAGATGAGGG + Intergenic
987104810 5:14627783-14627805 GAGTACAAATGGGGAGATGTAGG + Intergenic
987695731 5:21328957-21328979 CAGTAAAGATGGAGAGAAATAGG + Intergenic
987760373 5:22154373-22154395 TAGGGGAAATGGAGAGATGTTGG - Intronic
987777402 5:22385849-22385871 CAGGAGAAAGGGAGAGAAGGTGG + Intronic
987823548 5:22997422-22997444 TCGTAAAAATAGAGATAAGTTGG + Intergenic
987879531 5:23725030-23725052 AGGAAGAAATGGAGAGAAGGGGG - Intergenic
987982682 5:25107617-25107639 AAGTAGAAAAGGAGATAAATGGG + Intergenic
988088316 5:26501363-26501385 TATTAGAAAAGTAAAGAAGTGGG - Intergenic
988156097 5:27450820-27450842 AGGAGGAAATGGAGAGAAGTAGG + Intergenic
988207080 5:28152351-28152373 TCATAGAAATGGAGAGTAGAGGG - Intergenic
988386602 5:30573888-30573910 GAGGAGAAATGGAGAAATGTGGG + Intergenic
988438149 5:31200669-31200691 AAGGAGAAAGGGAGGGAAGTTGG + Intronic
989121121 5:38005413-38005435 TAGTAGAAAGGAAGAGAAAGAGG + Intergenic
989239176 5:39183795-39183817 TATTAAAAATGGAGATACGTAGG + Intronic
989414260 5:41155214-41155236 AAGTAGAAATTGAGAGGACTTGG - Intronic
989590541 5:43108817-43108839 TTTTAGAAATGGAGATAATTCGG - Intronic
990033719 5:51293452-51293474 TTTTAGGAATGGAGAGAAGAAGG - Intergenic
990058563 5:51617756-51617778 TAGAGGAGATGGAGAGAGGTTGG - Intergenic
990433649 5:55765064-55765086 TAGGAGAAAAAAAGAGAAGTAGG - Intronic
990768564 5:59216426-59216448 TAGTAGGGATGGAAGGAAGTGGG - Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991744670 5:69723135-69723157 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991753033 5:69832098-69832120 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991796241 5:70302859-70302881 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991802651 5:70388825-70388847 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991824052 5:70598449-70598471 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991832353 5:70707217-70707239 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991888619 5:71302418-71302440 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991895122 5:71387788-71387810 TTGGGGAAATGGAGAGATGTTGG - Intergenic
992590088 5:78285847-78285869 TGGTGGTAGTGGAGAGAAGTGGG - Intronic
992955100 5:81900505-81900527 AAAAAGAAAGGGAGAGAAGTTGG + Intergenic
993025348 5:82638995-82639017 TAATTGTAATGGAGAGAAATGGG - Intergenic
993355564 5:86902990-86903012 TAGTGGAAAAGGAGAAAAGTGGG - Intergenic
993541013 5:89151649-89151671 GAGGAGTAATGAAGAGAAGTCGG - Intergenic
993626953 5:90237256-90237278 TTGTAGAAATAGATAAAAGTGGG - Intergenic
993844914 5:92929567-92929589 TGGTAGAGATAGAAAGAAGTGGG + Intergenic
994736077 5:103558168-103558190 TAGTAGAAATGGAGGAAAGAGGG - Intronic
995752072 5:115462520-115462542 AGGGAGAAATGAAGAGAAGTTGG - Intergenic
996108294 5:119533417-119533439 TAGTAATAATGGAGAGGAGAGGG + Intronic
996254498 5:121382210-121382232 TAGTAAAGATGTAGAAAAGTTGG - Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996456518 5:123689989-123690011 TGGTAGAAATGGTGAGTAGAAGG + Intergenic
997305217 5:132831156-132831178 TGGGAGAAATGGAAAGAAATGGG - Intergenic
997324163 5:133005773-133005795 AAGTAGAAAAGGAGACCAGTAGG + Intronic
998400691 5:141847359-141847381 GAGTAGAAATGGAGGGGAGTTGG - Intergenic
998717487 5:144902122-144902144 TAGGAGAGAGGGAAAGAAGTAGG + Intergenic
1000034239 5:157431114-157431136 TATTAGTAATGAAGAGAAGCAGG + Intronic
1000116466 5:158158624-158158646 TAGTGGGAATGAAGAGAAGAGGG - Intergenic
1000669913 5:164048153-164048175 TAGTTGAAATGGAATGAGGTAGG + Intergenic
1001061733 5:168496457-168496479 AAGCAGAGAGGGAGAGAAGTGGG + Intronic
1001075356 5:168623069-168623091 TGGAAGAAATGGGGAGATGTTGG - Intergenic
1001468473 5:171990108-171990130 AAGGAGAAAAGGAGAGAAATGGG + Intronic
1001578561 5:172781936-172781958 TAGGGGAAATGGGGAGATGTTGG + Intergenic
1002736685 5:181394985-181395007 TAGTGGAAATAGAGATAAGGAGG - Intergenic
1002748015 6:79838-79860 TAGTGGAAATAGAGATAAGGAGG + Intergenic
1002883475 6:1273404-1273426 GGGTAGAAATGAAGAGAGGTTGG + Intergenic
1003366161 6:5476795-5476817 GAGTGGAAATGGGGAGAGGTGGG + Intronic
1004240316 6:13915493-13915515 TAGTGGAAATGAAAAGGAGTAGG + Intergenic
1004708931 6:18151857-18151879 TATAAGAAAAGAAGAGAAGTGGG + Intronic
1005162606 6:22881570-22881592 TAGTACAAATTGAGACAAATTGG - Intergenic
1005286549 6:24333856-24333878 TGGCAGAAGTGGAGAGAAGAGGG + Intronic
1005555054 6:26969109-26969131 CAGTAAAGATGGAGAGAAATAGG - Intergenic
1005907125 6:30272469-30272491 TAGGGGAAATGGGGAGATGTTGG + Intergenic
1005907293 6:30274577-30274599 TGGGAGAAATGGGGAGATGTTGG + Intergenic
1006207415 6:32360171-32360193 TGGAAGAAATGGGCAGAAGTTGG - Intronic
1006470494 6:34226074-34226096 GAGTAGAAATGGATAAAAGATGG - Intergenic
1006477218 6:34264328-34264350 TAGGGGGAATGGAGAGATGTTGG - Intergenic
1006609570 6:35286098-35286120 GAGTGGAAATAGAGAGAAATGGG - Intronic
1006762840 6:36478482-36478504 AAGTAGAAAAGGAGGGTAGTAGG - Intronic
1007060052 6:38930894-38930916 TGGGAGAAATGGGGAGATGTTGG - Intronic
1007463511 6:42035322-42035344 CAGTAGAAATGGAAACAAGGGGG - Intronic
1007821722 6:44565278-44565300 GAGTAGACTTGGAGAGAAGAGGG - Intergenic
1008387884 6:50915250-50915272 GAGAAGAAATTGAGAGATGTAGG - Intergenic
1008640561 6:53458280-53458302 TGCTAGAAAGGAAGAGAAGTAGG - Intergenic
1008798476 6:55337138-55337160 GAGGAGAAATGGAGAGAAGTTGG - Intronic
1009333862 6:62460209-62460231 TAGTTGAAATGGATAGATATGGG - Intergenic
1009602569 6:65821264-65821286 TAGGAGAAAGAGAGAGAAGGGGG + Intergenic
1009609070 6:65914822-65914844 TAGTGGAGATTGAGAGGAGTTGG - Intergenic
1011379577 6:86728237-86728259 TAAGAGAAATGGAGACATGTTGG + Intergenic
1011943172 6:92868677-92868699 TGGTAGAAATTGAGGCAAGTGGG - Intergenic
1012241253 6:96875505-96875527 CAGTAGAAATGGAGAAAAGATGG - Intergenic
1012300130 6:97577060-97577082 AAGTATAAATGAAGAGAAATGGG + Intergenic
1012668291 6:102007262-102007284 TAATTGAAAAGGAGAGAAATGGG + Intronic
1013688543 6:112613536-112613558 TGGGAGAAATGGGGAGATGTTGG - Intergenic
1013922832 6:115429507-115429529 TGGGAGAAATGGGGAGAAGTTGG + Intergenic
1014020552 6:116583364-116583386 TAGTAGGAATGGTGAGATGCTGG + Intronic
1014378392 6:120706397-120706419 GAGGAGAAAAGGAGAGATGTTGG + Intergenic
1014391048 6:120864857-120864879 TAGCAGGATGGGAGAGAAGTGGG + Intergenic
1014588274 6:123228724-123228746 TACTAGAATCAGAGAGAAGTGGG - Intronic
1014887569 6:126800235-126800257 TAGGAGAAATGGGGAGATGTTGG + Intergenic
1014921646 6:127220731-127220753 TAATAGAAATGATGAGAAGTAGG - Intergenic
1015094296 6:129396375-129396397 TAGCAGAAGTGGAGAGGAATTGG + Intronic
1015342610 6:132119010-132119032 TAGGAGAAATGGAGAGGATTAGG + Intergenic
1015364731 6:132385002-132385024 TAGTATCACTGGAGAGAGGTGGG + Intronic
1015510222 6:134031040-134031062 GAGTGGAACTGGAGATAAGTAGG + Intronic
1016279725 6:142401729-142401751 GTGGAGAAATGGAGAGAATTTGG + Intronic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1016975805 6:149806440-149806462 TAGTAAGGATAGAGAGAAGTGGG + Intronic
1017359046 6:153544088-153544110 TAATAGAAACTGAGATAAGTAGG - Intergenic
1017726519 6:157279951-157279973 TCGTAAAAATAGAGATAAGTTGG + Intergenic
1017783221 6:157732864-157732886 TGGCAGAAATGGAGAGATGTTGG - Intronic
1018406614 6:163490776-163490798 TGGAAGAGATGGACAGAAGTGGG + Intronic
1019087495 6:169493543-169493565 TAGTGGAAATGGAGAAAAACAGG - Intronic
1019241783 6:170670514-170670536 TAGTGGAAATAGAGATAAGGAGG - Intergenic
1020286212 7:6683084-6683106 TAGCAGAAAGGGAGAGAGGATGG + Intergenic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020495437 7:8845859-8845881 TAGAAGAAAAGGAGAGCTGTAGG + Intergenic
1020661424 7:10988259-10988281 TAATAGATGTGGAGAGAAATTGG + Intronic
1020790386 7:12620337-12620359 TAGAGGAAATGGAGAAATGTTGG - Intronic
1021452689 7:20797659-20797681 TAGAATAAATGGCGAGTAGTGGG + Intergenic
1021568979 7:22045250-22045272 TATTAGTAATAGAGAAAAGTGGG + Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021748663 7:23772745-23772767 TAATAGAACTGGAGAGGATTAGG + Intronic
1021946286 7:25731002-25731024 CAGTAGAGATGGAAAAAAGTGGG - Intergenic
1022275481 7:28851332-28851354 TAGAAGAAAGGGAGAGGAATTGG - Intergenic
1022422926 7:30241052-30241074 TATTAGGAATGGAGAGAGGTGGG + Intergenic
1022552471 7:31254282-31254304 TAGGGGAAATGGAGAGATGTTGG - Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1023206378 7:37754794-37754816 TAGTTGAAATGGGGAGATGTTGG - Intronic
1023472647 7:40541277-40541299 TGGCAGAAATGTAGAGATGTGGG + Intronic
1023724451 7:43127659-43127681 TCATAGAATTGGAGAGAATTAGG - Intronic
1024316544 7:48024514-48024536 TAGTGGAAATGTAGAGAAATTGG + Intronic
1024379739 7:48682551-48682573 GAGAAGAAATGGGGAGATGTAGG + Intergenic
1024454980 7:49595118-49595140 TATTAGAAATGCAAAGAAGCAGG + Intergenic
1026260470 7:68750865-68750887 TGGGAGAAATGGGGAGATGTCGG - Intergenic
1027279980 7:76602092-76602114 TGGTGGAAATGGATAAAAGTGGG + Intergenic
1027484700 7:78746819-78746841 TAGTGAAAGTGGAGAGAATTGGG - Intronic
1027918078 7:84352236-84352258 TAGTGGAAAGTGGGAGAAGTGGG + Intronic
1030139648 7:106291750-106291772 TTGGAAAAATAGAGAGAAGTTGG - Intergenic
1030350260 7:108476985-108477007 TAGGGGAAATGGAGAGATGTTGG + Intronic
1030522358 7:110613805-110613827 TAGTAAGAATGCAGAGAAATTGG + Intergenic
1030802766 7:113873415-113873437 TAAGAGAAATGGAGAGAAAAGGG + Intergenic
1031150117 7:118044467-118044489 TATTGGTAATGGAGAGAAATAGG + Intergenic
1031287964 7:119896383-119896405 TACAAGAATGGGAGAGAAGTGGG - Intergenic
1031638208 7:124127609-124127631 TAGTTGAAATGTTTAGAAGTTGG + Intergenic
1031672778 7:124570734-124570756 CAGGAGAAATGGGGAGATGTTGG - Intergenic
1032016246 7:128381935-128381957 GAGGAGAAAGGGACAGAAGTAGG + Intergenic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032853623 7:135816169-135816191 TGGTTGAGATGCAGAGAAGTGGG + Intergenic
1033083836 7:138323629-138323651 AAGCAGAAAAGGAGAGATGTTGG + Intergenic
1033183185 7:139200760-139200782 TAGGAGATATGGGGAGATGTTGG - Intergenic
1034523490 7:151639230-151639252 TAGCAGGGATGGAGACAAGTGGG - Intronic
1035506333 8:137582-137604 TAGTGGAAATAGAGATAAGGAGG + Intergenic
1037246399 8:16840585-16840607 TAGAAGTGATGAAGAGAAGTTGG + Intergenic
1037403046 8:18512916-18512938 TAGGAAAAATGGGGAGATGTTGG - Intergenic
1037799654 8:22025408-22025430 GAGGAGAAAGGGAGGGAAGTGGG - Intronic
1037972256 8:23180989-23181011 GAGGAGTAATGAAGAGAAGTGGG + Intergenic
1038332455 8:26619639-26619661 TAGTAGAAATGCAGATTACTGGG + Intronic
1038506275 8:28087747-28087769 TAGATGAAATGGAGAAAATTAGG - Intergenic
1039158719 8:34592956-34592978 GAGTGGCAATGGAGAGATGTTGG + Intergenic
1039701842 8:39970161-39970183 TTGTAGAATTGAAGAGAATTAGG - Intronic
1040035351 8:42864545-42864567 TCAAAGAAATGGAGAGAATTTGG + Intronic
1040674019 8:49726917-49726939 TACTAAAAATTGAGAGAACTGGG + Intergenic
1041449610 8:57993315-57993337 TACTTGAGAGGGAGAGAAGTTGG + Intergenic
1041800051 8:61788936-61788958 TAGGGGAAATGGAGAGATGTTGG - Intergenic
1042016138 8:64314623-64314645 CAGCAGAGAGGGAGAGAAGTGGG + Intergenic
1042070971 8:64933164-64933186 TGGTAGAAATGTAGAGAAAGAGG - Intergenic
1042708956 8:71693787-71693809 TAATAGAAATGGGGGAAAGTAGG - Intergenic
1043196350 8:77297149-77297171 TAGTAGAGGTGGAAAGAAGCAGG - Intergenic
1043199717 8:77351376-77351398 TAGTTGGAATGGAGATAAGATGG - Intergenic
1043346657 8:79305450-79305472 TGGGAGAAATGGGGAGATGTTGG - Intergenic
1043777757 8:84291346-84291368 TAGTAAAAAGGTACAGAAGTTGG + Intronic
1044034462 8:87283099-87283121 TAGAAGAAATGGAAATAAGAAGG - Intronic
1044334138 8:90957648-90957670 TAGTAGAAAAGGAAACTAGTAGG + Exonic
1044340055 8:91036542-91036564 TGGTAGAGATGGAGAGATGAAGG - Intronic
1044350765 8:91163558-91163580 AAGTGGAAGTTGAGAGAAGTAGG - Intronic
1044478282 8:92654243-92654265 TAGTAGAGAGGGGGAGAAGAGGG + Intergenic
1044557298 8:93577425-93577447 CTGTACAAATGGAGAGAAGTGGG + Intergenic
1044645361 8:94436731-94436753 TAGTAGAAAAGAATAGATGTTGG - Exonic
1044740473 8:95321378-95321400 GAGCAGAAATGGAGAAAAGGAGG - Intergenic
1045342244 8:101265522-101265544 TAGTAGAAATGTAGAAATTTTGG - Intergenic
1045370623 8:101518753-101518775 TAGCAGAGATGGAAAGAACTTGG - Intronic
1045530668 8:102982150-102982172 TAGTGTAAGTGGTGAGAAGTTGG + Intergenic
1045743445 8:105388304-105388326 AAGAAGAAATGGAGAGAAAAGGG + Intronic
1045781244 8:105865571-105865593 TAGTAGAAATAGAGACAGGATGG - Intergenic
1046079320 8:109352000-109352022 TATTAGTGCTGGAGAGAAGTGGG - Intergenic
1046323526 8:112610018-112610040 TAGGGGAAATGGTGAGATGTCGG + Intronic
1046905902 8:119572893-119572915 TACTGGAAATGGAGTGAAGGTGG + Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047939777 8:129818086-129818108 CAGGAGAGATGGAGAGATGTAGG - Intergenic
1048258391 8:132923570-132923592 TTTTAGAAAGGGAGAGAAGCTGG + Intronic
1048710120 8:137200629-137200651 TAGTAGTAAGTGAGAGAAGAAGG + Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1050782606 9:9356604-9356626 AAGTAGTGATGGGGAGAAGTAGG + Intronic
1051058661 9:13019631-13019653 TGGTAAAAATGTGGAGAAGTTGG - Intergenic
1051558751 9:18415178-18415200 TAGCAGCAATGCAAAGAAGTGGG + Intergenic
1051698270 9:19791603-19791625 TGGTAGTAATGGAGAAAAGCAGG + Intergenic
1052148406 9:25079178-25079200 TGGGAGAAATGGAGAGAAACTGG - Intergenic
1052247587 9:26355331-26355353 TGGGAGAAATGGAAAGATGTTGG + Intergenic
1053025012 9:34722217-34722239 CAGTAGAGAGGGTGAGAAGTGGG + Intergenic
1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG + Intronic
1056284888 9:85077796-85077818 TTGGAGAATTGCAGAGAAGTGGG - Intergenic
1056673396 9:88651347-88651369 GAGCAGAGATGGAAAGAAGTGGG + Intergenic
1057594736 9:96405461-96405483 TATTAAAAATGTAGAGAAATTGG + Intronic
1058170471 9:101674427-101674449 TAGCAGAAATGGAGAGGAGATGG + Intronic
1058305202 9:103432924-103432946 CAGAAGAAATGGAGAAAAGATGG - Intergenic
1059042794 9:110831979-110832001 TAGTAAAAATGGAGGGAAACAGG - Intergenic
1059131361 9:111753893-111753915 TAGGGGAAATGAGGAGAAGTTGG + Intronic
1059355560 9:113696852-113696874 AAGGAGAAATAGAGAGAAGGGGG - Intergenic
1059468255 9:114483382-114483404 TTGTAGAAATGGAGACAAGAAGG - Intronic
1059905285 9:118977141-118977163 TGGTAGAAATGAAGAGGAGTGGG + Intergenic
1059917099 9:119116287-119116309 ACCTAGAAATGGAGAAAAGTGGG + Intergenic
1060391710 9:123283202-123283224 TAGAATAAATGCAGAGAAATGGG - Intergenic
1061583163 9:131549856-131549878 TAGTTGAAATGCAGATAATTTGG - Intergenic
1061747394 9:132750413-132750435 TAGAAGAAATGAAGAGGAGCCGG - Intronic
1203601974 Un_KI270748v1:19748-19770 TAGTGGAAATAGAGATAAGGAGG - Intergenic
1185661797 X:1734289-1734311 AAGTAGAATTGAAGAGAAGCGGG + Intergenic
1185922232 X:4106538-4106560 TGGGGGAAATGGAGAGATGTTGG - Intergenic
1186955346 X:14675592-14675614 TATTAGATATGGAGAGAAAATGG + Intronic
1187148505 X:16659899-16659921 TGGGAGAAATGGGGAGATGTTGG - Intronic
1187418106 X:19111015-19111037 TAGTAGGAGTAGAGAGAAGTGGG + Intronic
1187759775 X:22568375-22568397 TAATAGAAACTGAGAGAAATAGG - Intergenic
1187967388 X:24625757-24625779 TAGTAAAAAGAGAGAGAAGGGGG + Intronic
1188465058 X:30470367-30470389 CAGTAGAAATGGTGAGTAGTGGG - Intergenic
1188658088 X:32723515-32723537 TGGAAGAAATGAGGAGAAGTAGG + Intronic
1188825480 X:34827745-34827767 TAGGAGAAATGGGAAGATGTTGG + Intergenic
1189081997 X:37983571-37983593 TTCCAGTAATGGAGAGAAGTAGG + Intronic
1189319917 X:40081747-40081769 TTCTAGTAGTGGAGAGAAGTGGG + Intronic
1189684955 X:43554325-43554347 TTGTAGAAATGGACAGAGGTGGG - Intergenic
1189796484 X:44650740-44650762 TAAAAGAAATGGAGAGAGGCTGG + Intergenic
1190814186 X:53914329-53914351 TCGTAGAATTGAAGAGAATTAGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191219506 X:57972724-57972746 TTGTTGATATGGAGAGAAATGGG + Intergenic
1191754529 X:64580150-64580172 TAGGAGAAGGGGAGGGAAGTGGG + Intergenic
1191792047 X:64981428-64981450 TAGTAGATATGAAGAAAAATGGG + Intronic
1192115051 X:68402082-68402104 AAGGAGAAAGGGATAGAAGTTGG + Intronic
1192571461 X:72209604-72209626 TAGTAGAGATGGAAAGAAGGTGG - Intronic
1192655495 X:72989070-72989092 TAGTAGAGATAGAGAGTACTTGG + Intergenic
1193692506 X:84664052-84664074 TAGCAATAATGTAGAGAAGTTGG - Intergenic
1193843345 X:86437414-86437436 TAGGAGGAATGGATAGAAGTTGG - Intronic
1193965269 X:87976837-87976859 CAGGAGAAAGAGAGAGAAGTGGG - Intergenic
1194568309 X:95521494-95521516 CAGTAGAAAGGGAGAAAAGGAGG + Intergenic
1194621075 X:96172799-96172821 AAGGAGAAAAGGAGAGAAATGGG + Intergenic
1194677244 X:96809166-96809188 AAGTTGCAATGGAGAGAAGACGG - Intronic
1195077149 X:101338096-101338118 AAGCAGAAATGGAGAGAAGGAGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195413867 X:104599060-104599082 TGATAGAAATGGGGTGAAGTGGG + Intronic
1195497747 X:105557207-105557229 TAATAGAAATGCAGAGAAAGAGG - Intronic
1195598918 X:106724254-106724276 TAGTGGACATGAAGAGAAGTGGG - Intronic
1195692948 X:107643813-107643835 TAGTAGTAATGGAGAGTACAGGG + Intronic
1196083895 X:111663071-111663093 AATTAGAAATGGAGAGAGATGGG + Intergenic
1196095839 X:111799101-111799123 TATTAGTAAGGAAGAGAAGTGGG + Intronic
1196125546 X:112095042-112095064 TAGTAGAAAAGGAGAGGAGAAGG + Intergenic
1196470942 X:116026307-116026329 TAGGAGAAATGGAGATATGGTGG - Intergenic
1196666547 X:118323179-118323201 TAGTGGACTTGGAAAGAAGTTGG - Intergenic
1197198838 X:123731882-123731904 TACTAGAAATGGAGAGGGGTGGG + Intronic
1197415784 X:126171057-126171079 TAGAAAATATGGAGAGGAGTAGG - Intergenic
1197867230 X:131032255-131032277 GAGGGGAAATGGAGAGATGTTGG - Intergenic
1198187408 X:134266951-134266973 CAGGAGAAGGGGAGAGAAGTGGG + Intergenic
1198416704 X:136427641-136427663 TTGGAGAAATGGGGAGATGTTGG - Intergenic
1198602530 X:138299664-138299686 TGGTTGTAATGGAGAGAATTGGG + Intergenic
1198919740 X:141712139-141712161 TGTTAGACATGGTGAGAAGTGGG + Intergenic
1199073659 X:143506866-143506888 GAGAAGAAGTGGGGAGAAGTAGG + Intergenic
1199226100 X:145376536-145376558 TAGTAGAGATGGAGACAAGGAGG + Intergenic
1199260199 X:145764325-145764347 TCATAGAACTGGAGAGAATTAGG - Intergenic
1199316543 X:146385336-146385358 AAGTAGGAATAGAGAGAAGATGG + Intergenic
1199460029 X:148074126-148074148 TTGGAGAAATGGGGAGATGTTGG + Intergenic
1199784112 X:151089140-151089162 TAGTGGATATTGAGAGAAATTGG - Intergenic
1199923316 X:152433821-152433843 TATTAGAAATGAAGACAAGTGGG + Intronic
1200945213 Y:8828811-8828833 TGGTAGAGATGGTGAGAAGTGGG + Intergenic
1201382047 Y:13391586-13391608 AAGGAGAAATGGTGAGCAGTGGG - Intronic