ID: 1097790156

View in Genome Browser
Species Human (GRCh38)
Location 12:63806962-63806984
Sequence GTGGAAGCCCAGATTATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097790156_1097790160 3 Left 1097790156 12:63806962-63806984 CCTCCAATAATCTGGGCTTCCAC 0: 1
1: 0
2: 1
3: 8
4: 145
Right 1097790160 12:63806988-63807010 ACCTCAGCCATTCTCTCTCATGG 0: 1
1: 1
2: 6
3: 23
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097790156 Original CRISPR GTGGAAGCCCAGATTATTGG AGG (reversed) Intronic
900797890 1:4720371-4720393 GGGGAAGCCAAGTTTGTTGGAGG + Intronic
903944373 1:26952338-26952360 GTGGAGGCCCAGATGCTGGGCGG + Exonic
905022738 1:34828857-34828879 GTGGAAGAGCAGAGTATTTGAGG + Intronic
905626813 1:39494891-39494913 GTGGAAGCCCAGGCTGTGGGTGG + Intronic
905670129 1:39785928-39785950 GTGGAAGCCCAGGCTGTGGGTGG - Intronic
908617663 1:65940510-65940532 GTGGAAGCAGAGATTATTGCAGG + Intronic
908984500 1:70000608-70000630 GGAAAAGCCCAGCTTATTGGAGG - Intronic
911833741 1:102589034-102589056 CTGGAAGCTCAGATAATTGTTGG - Intergenic
912548452 1:110467836-110467858 GTGGAGGCCAAGATCAATGGCGG - Intergenic
914336993 1:146724557-146724579 GTGGCAGCACAGCTCATTGGTGG + Intergenic
914940071 1:152014727-152014749 GTGGCAGCCCAGAGGATGGGAGG + Intergenic
915372119 1:155360012-155360034 CTGTAATCCCAGTTTATTGGAGG - Intronic
916038817 1:160944915-160944937 GTGCAAGCCCAGAATATGTGAGG + Intergenic
916670977 1:167019943-167019965 GTAGAAGACAAGATTATTGAAGG - Intronic
916926236 1:169523980-169524002 GTGGAAAACCAGATCCTTGGAGG + Intronic
1065439461 10:25735972-25735994 GTGGAAGAGCAGATTTCTGGAGG - Intergenic
1065656060 10:27951476-27951498 GTGGTATCCCAGATTATTGGAGG + Intronic
1065808854 10:29422119-29422141 GTGGAAGACCAGCAGATTGGAGG + Intergenic
1068396458 10:56467950-56467972 GTTGAAGATCAGATTATTGTAGG - Intergenic
1070871024 10:79753127-79753149 GTTGAAGATCAGATTATTGTAGG - Intergenic
1070917436 10:80163902-80163924 GTCAAAGCCCAAAGTATTGGGGG + Intronic
1071502325 10:86212623-86212645 GTGGAGGTTAAGATTATTGGAGG - Intronic
1071637952 10:87275340-87275362 GTTGAAGATCAGATTATTGTAGG - Intergenic
1071657293 10:87462611-87462633 GTTGAAGATCAGATTATTGTAGG + Intergenic
1072227517 10:93384116-93384138 GTGCAAGCCCAGATTCCAGGAGG + Intronic
1074478081 10:113791022-113791044 GTGGAACCCCTGGTTGTTGGGGG - Intergenic
1077900642 11:6484951-6484973 GAGGAAGACCAGATTATGGAAGG - Intronic
1079956336 11:26870151-26870173 GTGGAAGCCAAGTTTAGTTGGGG + Intergenic
1080463399 11:32475223-32475245 GTGGAAGCCAAGAATCTTTGTGG - Intergenic
1080858331 11:36131200-36131222 GTTTAAGCACAGATTACTGGTGG - Intronic
1081714643 11:45240700-45240722 GTGGAATCACAGATTAATGAGGG + Exonic
1082773854 11:57230814-57230836 GTGGATGCCGAGAATACTGGGGG - Intergenic
1082916000 11:58438031-58438053 ATGGAAGAGCAGATTTTTGGAGG - Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1085795564 11:79536574-79536596 GGGGAAACCCAGATGAATGGAGG + Intergenic
1087163086 11:94970108-94970130 GTGAGAGCCCAGAAGATTGGAGG + Intronic
1087961683 11:104358513-104358535 GTGGAAGAACAGATTATTTAAGG - Intergenic
1090153691 11:124413665-124413687 GTGGAAGCATTGAGTATTGGTGG - Intergenic
1091632741 12:2174161-2174183 GTGGTATCCCAGATAAATGGTGG + Intronic
1092226604 12:6752373-6752395 ATGGAAGCTCAGATACTTGGAGG + Intronic
1097790156 12:63806962-63806984 GTGGAAGCCCAGATTATTGGAGG - Intronic
1099717526 12:86315212-86315234 GTCAAAGACCAGATTATTGCAGG - Intronic
1102673512 12:114640028-114640050 AGGGAACCCCAAATTATTGGTGG + Intergenic
1103017701 12:117508611-117508633 GTGGATGGCTAGATTAATGGTGG + Intronic
1103157619 12:118699930-118699952 GTGGAAGCCCAGTTGCATGGAGG - Intergenic
1103744824 12:123115282-123115304 TCAGAAGCCCAGATTATTGGAGG + Intronic
1107571079 13:41658774-41658796 GTGGAAGCAGAGAGCATTGGTGG + Intronic
1110151441 13:72259615-72259637 GTGTAAGACCAGATACTTGGAGG + Intergenic
1111299329 13:86326191-86326213 GTTGAAGATCAGATAATTGGAGG - Intergenic
1111688240 13:91527824-91527846 GTGGAAGCCCCAAGTCTTGGTGG - Intronic
1112600388 13:100849848-100849870 GTCTAAGCCCAGATCACTGGTGG + Intergenic
1112761145 13:102694796-102694818 GTGGAAGCCCAAGTTATTTAGGG + Intergenic
1115751479 14:36497286-36497308 GTGGAAGACCACATGATTGCTGG - Intronic
1116253906 14:42525084-42525106 GAAGAAGCCAAGATTACTGGGGG - Intergenic
1119567450 14:75640809-75640831 GAGGATGCCCAGATCATTAGAGG + Intronic
1122014251 14:98780342-98780364 GTGGAAGCCCAGATGATGTGGGG + Intergenic
1122440346 14:101727410-101727432 GTAGAAGGCAAGATCATTGGAGG - Intergenic
1126217549 15:46173772-46173794 CTGGAAGAGCATATTATTGGTGG - Intergenic
1126635970 15:50780163-50780185 GTGGAAGACCAGATTATGAAAGG + Intergenic
1131062621 15:89413246-89413268 GGGGAAGCCCAGCTTATGTGGGG - Intergenic
1133541628 16:6761215-6761237 TTTGAAGCCCAGGTAATTGGGGG + Intronic
1139997276 16:70992762-70992784 GTGGCAGCACAGCTCATTGGTGG - Intronic
1145108182 17:20137897-20137919 GTGGAAGGGCGGATTATTTGAGG - Intronic
1148618252 17:49015635-49015657 GTGGAAGCACAGAGAATGGGGGG - Intronic
1149728354 17:58920328-58920350 GTGGAAGACAAGATCACTGGAGG - Intronic
1153919770 18:9778215-9778237 GTGCCAGCCCAGATTAAAGGGGG + Intronic
1156650579 18:39221874-39221896 GAGGAAGCCTAGATTATAGTTGG + Intergenic
1159803058 18:72924045-72924067 GTGCAAGCCCCGAGTCTTGGTGG - Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1165077096 19:33285917-33285939 TTGGAATCCCAGCTTCTTGGGGG - Intergenic
1165221203 19:34317995-34318017 GTGGAAGCCCAGGAGTTTGGGGG + Intronic
925284994 2:2709931-2709953 GAGGAAGCCCAGATGCTTGTCGG - Intergenic
928853095 2:35772388-35772410 GTTGAAACTCATATTATTGGTGG - Intergenic
929064151 2:37956177-37956199 GTGAAAGCCCAAATATTTGGTGG - Intronic
929763507 2:44825499-44825521 GTGGAAGCTCAGGAGATTGGGGG + Intergenic
934713563 2:96530571-96530593 CTGGAAGCCCAGGCTTTTGGGGG - Intergenic
935254115 2:101293435-101293457 CTAGAAGCTCAGATTCTTGGAGG - Intronic
936655830 2:114485820-114485842 GTGGAAGTTCAGATAATTGTGGG - Intronic
940456536 2:153908682-153908704 GTGGAAGACCAGATGGTTGTAGG + Intronic
943297708 2:186159759-186159781 GTTGAAGATCAGATTATTGTAGG - Intergenic
1169415904 20:5416029-5416051 GTTGCAGCCCAGATCCTTGGAGG - Intergenic
1169650636 20:7863311-7863333 GTTGAAGACCAGATCATTGTAGG - Intergenic
1170151677 20:13233240-13233262 TTGGAAGCCAAGTTTATTGCTGG + Intronic
1174146758 20:48457454-48457476 GAGGAGGCCCAGAGTCTTGGGGG - Intergenic
1181529197 22:23506872-23506894 GTGGAAACCCAGATTGGTGCCGG + Intergenic
1183773005 22:39943183-39943205 TTGGAAACCCAGATTATAAGTGG - Intronic
949342431 3:3044500-3044522 GAGGAAGCCCAGGTTATCCGTGG - Intronic
950874710 3:16261334-16261356 TTGGAAGCAGAGATTTTTGGTGG - Intronic
952587952 3:34915733-34915755 GTGGAAGCAATGTTTATTGGAGG + Intergenic
952707384 3:36392985-36393007 GTGGAAGACAAGATCATAGGAGG - Intronic
953232637 3:41078102-41078124 GTGTCAGACCAGGTTATTGGAGG - Intergenic
953500222 3:43425966-43425988 GTGGAAGCCAAGGTTCTTGTTGG - Intronic
956360244 3:68439682-68439704 GTGAATGCCCAGATTAAGGGTGG + Intronic
958759150 3:98286959-98286981 GTGGAAGACCAGATGGTTGTAGG + Intergenic
968654388 4:1772285-1772307 ATGGCGGCCCAGTTTATTGGGGG + Intergenic
969952219 4:10849425-10849447 GTGGAAGACCAGATGGTTGCAGG + Intergenic
971593372 4:28497325-28497347 GTGCAAGCCCCAATTTTTGGTGG + Intergenic
973143966 4:46802240-46802262 GTAGAAGCCCAGAAGATTGTAGG + Intronic
973617881 4:52697569-52697591 GTCAAAGACCAGATTATTGTAGG - Intergenic
978174963 4:105718767-105718789 TTGGAAGCCCTGCTTATTGTGGG + Intronic
980333166 4:131435819-131435841 GTGGAAGATCAGATGATTGTAGG + Intergenic
980794453 4:137662830-137662852 ATTGAAGCTCATATTATTGGTGG + Intergenic
981006530 4:139880836-139880858 GAGGAAGCCAAGATTAATGTGGG - Intronic
983738335 4:171091676-171091698 GTGGGAGCTCAGGTTATTGCAGG - Intergenic
984059974 4:174979549-174979571 GTGGCAACCCAGATTAAGGGTGG + Intergenic
986024670 5:3839408-3839430 GTGAAAGGCAAGCTTATTGGTGG + Intergenic
987057637 5:14210029-14210051 GTGGGAGCCCTGATTGCTGGAGG + Intronic
988204387 5:28115445-28115467 GTGGAAGCCCCAAGTTTTGGCGG - Intergenic
989509459 5:42267894-42267916 GTGGAAGCAGAGATTACTAGGGG - Intergenic
991711580 5:69414089-69414111 GATGAAGCCCAGCTTAATGGAGG + Exonic
991959945 5:72034521-72034543 GTGGAAGTCCAGCTTTCTGGAGG + Intergenic
993057406 5:82997910-82997932 GTGGAAGCCCAGCATAGTTGGGG - Intergenic
994687182 5:102969961-102969983 GAGGAAGCACAGATGATAGGTGG + Intronic
996018119 5:118563595-118563617 GAGAAAGGCCAGAATATTGGTGG + Intergenic
997046945 5:130330230-130330252 GTGCAAGCCCCAATTCTTGGTGG + Intergenic
997103025 5:130989392-130989414 CTGAAAGCACAGATTTTTGGGGG + Intergenic
1000633549 5:163617774-163617796 GTTGAAGGCCAGATTCTTGAGGG + Intergenic
1001876314 5:175204709-175204731 GTGGAAGACAAGATTATCAGGGG + Intergenic
1008324133 6:50156051-50156073 GTGTTAGCCTAGATTGTTGGTGG - Intergenic
1008680487 6:53866589-53866611 GTGGAAGGCCTCATTATTTGGGG + Intronic
1014860910 6:126467343-126467365 GTTGAAGATCAGATTGTTGGAGG - Intergenic
1016126304 6:140408396-140408418 GTGCAAGCCCAAAATCTTGGAGG + Intergenic
1019812619 7:3175602-3175624 GAGGCTGCCCAGATAATTGGAGG + Intergenic
1019903202 7:4040720-4040742 GTGGGTGGCCAGATTTTTGGAGG - Intronic
1022412551 7:30150289-30150311 GGGGAACCTTAGATTATTGGTGG + Intronic
1024629417 7:51235111-51235133 TTGGAAGTGCAGATTAGTGGAGG - Intronic
1025165908 7:56712117-56712139 CTGGAATCTCAGATTATGGGAGG - Intergenic
1026096868 7:67353429-67353451 CTGGAAGCCAGTATTATTGGAGG - Intergenic
1026442146 7:70454132-70454154 GTGGAAGCCCGCATCCTTGGTGG - Intronic
1033984761 7:147211515-147211537 GTCAAAGACCATATTATTGGAGG - Intronic
1034559876 7:151872952-151872974 GTGAAATCCCAGATTAATGGGGG - Intronic
1034669893 7:152849919-152849941 GTGGAAGACCAGGTCACTGGTGG + Intronic
1034669940 7:152850174-152850196 GTGGAAGACCAGATCACTGGTGG + Intronic
1034669968 7:152850355-152850377 GTGGAAGGCCAGATCACTGGTGG + Intronic
1034689305 7:153001058-153001080 GTGCAAGCCCCAAGTATTGGTGG - Intergenic
1036216530 8:6884278-6884300 CTGGAATCCCAGCTTCTTGGGGG - Intergenic
1038670818 8:29581465-29581487 GTTTAAGGCCAGATTGTTGGGGG - Intergenic
1043623118 8:82222784-82222806 GTGGAAGCCTAGTTTACTGCTGG + Intergenic
1043640754 8:82447482-82447504 GTTGAAGATCAGATTATTGCAGG + Intergenic
1045126562 8:99097146-99097168 GTGGGAGCACAAATTATTGATGG + Intronic
1046418091 8:113941400-113941422 GTGCCAGCCCAGATTAATGGTGG + Intergenic
1054744858 9:68843964-68843986 GAGGAAGCACAGAATACTGGAGG + Intronic
1054762072 9:69012870-69012892 CAGGAAGCCCAGATATTTGGAGG - Exonic
1055740685 9:79385270-79385292 GTTGAAGACCAGATGATTGTAGG + Intergenic
1056021602 9:82443731-82443753 GTGGATGCCTAGATTATTATGGG + Intergenic
1057706029 9:97395831-97395853 GTGGCAGCCCAGATTTCTGCGGG + Intergenic
1060188228 9:121576738-121576760 GTGGAAGGGCAGATTCTGGGGGG + Intronic
1191911760 X:66159229-66159251 TTTGAAGACCAGATTATGGGGGG + Intergenic
1192296572 X:69855605-69855627 GTGGAAGACCAGATGGTTGTAGG + Intronic
1195069157 X:101262800-101262822 GTAGAAGCCTAGATTGTGGGCGG + Exonic
1196577391 X:117335292-117335314 GTAGATGTCCACATTATTGGAGG - Intergenic
1196812870 X:119642599-119642621 GTGCAAGACCAGATTATCAGAGG + Intronic
1197965902 X:132061536-132061558 GTGGATGTCAAGATTAGTGGAGG + Intergenic
1198783488 X:140261477-140261499 GTGCCTGCCCAGATTATGGGTGG + Intergenic
1201608911 Y:15818444-15818466 GTGCAAGCCCTGTTTTTTGGGGG - Intergenic