ID: 1097794797

View in Genome Browser
Species Human (GRCh38)
Location 12:63850067-63850089
Sequence CACCCTGTGAAGCTGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 346}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097794797_1097794801 5 Left 1097794797 12:63850067-63850089 CCAGGCAGCAGCTTCACAGGGTG 0: 1
1: 0
2: 2
3: 50
4: 346
Right 1097794801 12:63850095-63850117 TAAGGTCTAGAAAAACAACATGG 0: 1
1: 0
2: 3
3: 15
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097794797 Original CRISPR CACCCTGTGAAGCTGCTGCC TGG (reversed) Intronic
900126517 1:1071191-1071213 CACCCTGTGAACTGCCTGCCAGG - Exonic
900432019 1:2606940-2606962 CTGTCTGTGAGGCTGCTGCCAGG + Intronic
900493929 1:2967585-2967607 CACCCTGTGCAGCCGCTGGCCGG - Intergenic
900653382 1:3742368-3742390 CACCCTGAGCTTCTGCTGCCAGG + Intergenic
900685347 1:3944629-3944651 CACACTGTGCAGCTGTTGGCGGG - Intergenic
900786552 1:4653916-4653938 CGCCCAGCGCAGCTGCTGCCTGG - Intergenic
900959236 1:5908872-5908894 CACCATGAGATGCAGCTGCCAGG + Intronic
901107484 1:6768426-6768448 CAGCTTGTGAAGATGCAGCCAGG + Intergenic
901940470 1:12657949-12657971 CATTGTGTGAAACTGCTGCCTGG + Intronic
902563335 1:17292799-17292821 CACCCTGTGGAGATTCTGACTGG - Intergenic
903228805 1:21909618-21909640 GACCCTTTGAAGCTGAAGCCAGG + Intronic
904052844 1:27650633-27650655 CACCCTATGAAGCTGCCTACAGG - Intergenic
905271012 1:36787457-36787479 CACCCTGGGAGGCTGGAGCCAGG - Intergenic
905294097 1:36943181-36943203 CACCCTGTGCAGAGGCTACCAGG - Intronic
905319259 1:37104346-37104368 GACCCAGCCAAGCTGCTGCCTGG - Intergenic
906147828 1:43570356-43570378 CTGCCTGTGAGGCTCCTGCCAGG + Intronic
910530285 1:88228158-88228180 CACACTCAGAAGCTGCTGGCAGG - Intergenic
911719491 1:101175128-101175150 CACACTTTGAAGCTTCTACCTGG - Intergenic
913081224 1:115389049-115389071 CGACCTGCGAAGCTGCAGCCAGG - Intergenic
913670039 1:121088746-121088768 CACTGTGTGGAGCTGCTCCCAGG - Exonic
914021804 1:143876144-143876166 CACTGTGTGGAGCTGCTCCCAGG - Intergenic
914877327 1:151521876-151521898 TACCCTGTTAAGCTGATCCCAGG - Intronic
917181441 1:172302295-172302317 CCCCCTGCTAGGCTGCTGCCTGG - Intronic
917191242 1:172421802-172421824 CACACTATGTGGCTGCTGCCAGG - Intronic
918238247 1:182600312-182600334 CACTCTGTCCAGCTGCAGCCTGG - Exonic
918616578 1:186551035-186551057 CAACCTGTGAGGCTGCAGCCGGG - Intergenic
920410336 1:205754458-205754480 CACTCTTTGGAGATGCTGCCAGG + Intergenic
921336627 1:214093244-214093266 AACCCTGTGAGGCTGCTACTAGG - Intergenic
922958993 1:229628970-229628992 CACCCTGGGCAGCACCTGCCAGG - Intronic
923919352 1:238546198-238546220 CACCCTCTGAGGCTACAGCCAGG + Intergenic
1063120600 10:3103156-3103178 CATTCTCTGAAGCTGTTGCCAGG + Intronic
1063519335 10:6726765-6726787 CAGCCTGTGAATCTGCTTGCTGG + Intergenic
1065157033 10:22881046-22881068 CAACCTGTGAGGCTGCAGCCTGG + Intergenic
1067153217 10:43753383-43753405 CACCATTTGGAGTTGCTGCCGGG - Intergenic
1067344737 10:45429036-45429058 CCCCCAGTCAAGGTGCTGCCAGG + Intronic
1067911439 10:50350654-50350676 CACCCTCTGAAGCCACAGCCCGG - Intronic
1069166427 10:65166405-65166427 CACCCTCTGAAGCTACGGTCTGG + Intergenic
1070846217 10:79524252-79524274 TACCCTGAGAAACTGGTGCCAGG + Intergenic
1070927581 10:80236058-80236080 TACCCTGAGAAACTGGTGCCAGG - Intergenic
1072336588 10:94403204-94403226 CCCGCTGCGGAGCTGCTGCCTGG + Exonic
1073978906 10:109131803-109131825 CAACCTGCGAGGCTGCAGCCGGG + Intergenic
1073998121 10:109339357-109339379 CAACCTGTGAGGCTGCAGTCTGG - Intergenic
1074113749 10:110440552-110440574 CTCCCGTTGAACCTGCTGCCAGG + Intergenic
1074317153 10:112370451-112370473 CACCCTCTGCAGCCGCTGGCCGG - Intergenic
1075312179 10:121423624-121423646 CACCCTGAGAGGATGCAGCCAGG - Intergenic
1076001625 10:126917559-126917581 GACCCTGTGAAGCTGAGGCAGGG - Intronic
1076413460 10:130267933-130267955 CACCCAGTGCATCTGCAGCCCGG - Intergenic
1076583707 10:131531737-131531759 CGCCGTGTGGAGCTGCTGGCCGG + Intergenic
1076648417 10:131970421-131970443 CGCCCTGTGGTGCTGCTGTCTGG - Intronic
1077351454 11:2095045-2095067 AGCCCTGGGAAGCTGCTCCCGGG - Intergenic
1077392167 11:2305172-2305194 CACCTCCTGGAGCTGCTGCCGGG + Intronic
1078053430 11:7987072-7987094 CACTTTGTGCAGCTGCCGCCAGG - Exonic
1078690007 11:13570236-13570258 CAACCTGTGAGGCTGCAGCCTGG + Intergenic
1079096893 11:17516932-17516954 TACTCTGTGGAGCTGCGGCCTGG - Intronic
1079653993 11:22965636-22965658 CAACCTGTGAGGCTGCAGCCTGG - Intergenic
1079689112 11:23400297-23400319 CACCCTCCGCAGCTGCTGGCTGG - Intergenic
1079801994 11:24880297-24880319 CACGCCATGAGGCTGCTGCCAGG + Intronic
1082184478 11:49163218-49163240 CACCCTGGGATGGAGCTGCCAGG - Intronic
1083065788 11:59922650-59922672 CACAGTATGCAGCTGCTGCCTGG - Intergenic
1083248313 11:61447606-61447628 CACCCAGTGAAGCTTCTGTGAGG + Intronic
1083595591 11:63917157-63917179 CACACAATGAAGCTGCTGGCAGG + Intergenic
1084447993 11:69215176-69215198 CACCCAGAGAAGGGGCTGCCAGG + Intergenic
1085049807 11:73374541-73374563 TACTCTATGGAGCTGCTGCCAGG + Intergenic
1085574519 11:77590096-77590118 CGGCCTGTGCAGCTGCTGCCGGG - Exonic
1086509822 11:87544233-87544255 CACCCTGTGAAACGGGTGCCTGG - Intergenic
1086571095 11:88285542-88285564 CACTTGGTGAAGCTGCTGCAGGG + Intergenic
1086681871 11:89682150-89682172 CACCCTGGGATGGAGCTGCCAGG + Intergenic
1087287505 11:96281231-96281253 CACCATGTGAAGGTGATTCCAGG + Intronic
1088626779 11:111735443-111735465 CCCCCGCTGAAGCTGCTGACGGG - Intronic
1090722984 11:129493865-129493887 CGACCTGTGAGGCTGCAGCCCGG + Intergenic
1091556353 12:1576446-1576468 CACCCTCTGGAGCTACTGCTCGG + Intronic
1091986651 12:4915097-4915119 CAACCTGTGAAGTGACTGCCAGG - Exonic
1092239000 12:6826285-6826307 GCCCAGGTGAAGCTGCTGCCTGG + Exonic
1093506889 12:19877663-19877685 CACCATGTGCACCTGCTGTCTGG - Intergenic
1096427460 12:51516240-51516262 CACTCAGTAAAGCTGCTGCTGGG - Intergenic
1097164861 12:57078589-57078611 CCCCCTTGGCAGCTGCTGCCCGG + Intronic
1097281301 12:57846626-57846648 CACCCGGGGGAGCCGCTGCCCGG - Exonic
1097794797 12:63850067-63850089 CACCCTGTGAAGCTGCTGCCTGG - Intronic
1098176028 12:67792357-67792379 CAACCTGCGAGGCTGCAGCCTGG - Intergenic
1098881048 12:75917894-75917916 TACCCTGTGATGCTACTTCCTGG + Intergenic
1099129012 12:78803368-78803390 AACTTTGTGATGCTGCTGCCAGG + Intergenic
1099740226 12:86625186-86625208 CACCTTGTGAAGAAGGTGCCTGG + Intronic
1100618635 12:96250478-96250500 CACCCCCTGAAGCAGCTCCCAGG - Intronic
1101033527 12:100683010-100683032 CACCTTGTGAAGCTGGAGGCAGG - Intergenic
1102609522 12:114099267-114099289 CACCCTGCCTAGATGCTGCCGGG - Intergenic
1103255433 12:119538144-119538166 CAACCTGTGAGGCAGCAGCCTGG - Intronic
1103896512 12:124277187-124277209 CACACTGTGAAGGTGCAGCTTGG - Intronic
1104589145 12:130070413-130070435 CTCGCGGTGAAGCTGCTGACGGG - Intergenic
1104768416 12:131345456-131345478 CCCCCTGTGACGGTGCTGGCTGG + Intergenic
1104843553 12:131835651-131835673 CACCCAGGCCAGCTGCTGCCTGG - Intronic
1105741181 13:23324595-23324617 CACGATGTGCAGCTGCTCCCTGG - Exonic
1105890878 13:24681313-24681335 CACCCTGAGGAGCTGCTGGCTGG + Intronic
1107806779 13:44160808-44160830 CACCCTGTGAGGCAGCTGGCTGG + Exonic
1108910958 13:55550937-55550959 CACCCTCTGAAGCAACAGCCTGG - Intergenic
1109566897 13:64130377-64130399 CACACTGTGCAGCTGTTGCCTGG - Intergenic
1111358666 13:87145328-87145350 CACCCTGTGAAGCAGGTGCGTGG + Intergenic
1111966201 13:94864642-94864664 AACCCGGGGAAGCTGCTGGCGGG + Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1112363525 13:98738556-98738578 CACCCTCTGAAGCAGCAGCCTGG - Intronic
1112753470 13:102605284-102605306 CCCCCAGGGAAGGTGCTGCCAGG - Intronic
1113589495 13:111488537-111488559 CACCTGCTGATGCTGCTGCCTGG - Intergenic
1113707926 13:112446121-112446143 AACGCCGGGAAGCTGCTGCCTGG - Intergenic
1113825337 13:113248072-113248094 CCTCCTGTGAAGGTGCTGGCTGG + Intronic
1115743209 14:36409782-36409804 CAACCTGTGAGGCTACAGCCTGG + Intergenic
1115843662 14:37502015-37502037 CCACCTGTGAGGCTGCAGCCTGG + Intronic
1116317923 14:43421498-43421520 CTTCCTTTGAAGCTACTGCCAGG + Intergenic
1116390530 14:44384883-44384905 CACCCTCTGCAGCCGCTGGCCGG - Intergenic
1118512471 14:66490630-66490652 GGCCCTGAGAAGCTGCTGACTGG + Intergenic
1119679877 14:76584388-76584410 CATCCTGACAAGCTGCTCCCTGG - Intergenic
1119797684 14:77414005-77414027 CACCTTGGGAAGCAGCTGGCTGG - Exonic
1120959869 14:90114862-90114884 CACACTGCGAGGCTGCTACCTGG - Intronic
1121694405 14:95901105-95901127 CACCTTCTGAAGCTGTTGCCTGG - Intergenic
1121745360 14:96285678-96285700 CTTCCTCTGAAGCTGCTGTCAGG + Exonic
1122088894 14:99325171-99325193 CACCCTGTGACACCACTGCCTGG + Intergenic
1122231689 14:100309253-100309275 CACCCTGTTTCCCTGCTGCCTGG + Intergenic
1122905055 14:104797780-104797802 CACCTTCTGCAGCTGCTGGCCGG + Intergenic
1122987815 14:105220667-105220689 CAGGCTGTGCAGATGCTGCCTGG - Intronic
1123117540 14:105901467-105901489 CACCCTGAGGAGGTCCTGCCAGG - Intergenic
1123118781 14:105907507-105907529 CCCCCTCTGATGCTGTTGCCTGG + Intergenic
1123118854 14:105907841-105907863 TCTCCTGTGATGCTGCTGCCTGG + Intergenic
1123429225 15:20200686-20200708 CACCTTGGCAAGCTGTTGCCAGG - Intergenic
1125524254 15:40365268-40365290 CCCCCTGGTAAGCTGCAGCCTGG + Exonic
1125887285 15:43238326-43238348 TCCCCTGTGACCCTGCTGCCAGG + Intronic
1128237840 15:66079758-66079780 GTTCCTGTGATGCTGCTGCCAGG - Intronic
1129116236 15:73366996-73367018 TGCCCTGGGAAGCTGCGGCCGGG - Intronic
1129543123 15:76367550-76367572 CAGCCTGAGGGGCTGCTGCCAGG - Intronic
1131589271 15:93730934-93730956 CAACCTGTGAGGCTGCAGGCTGG - Intergenic
1132212040 15:100031186-100031208 CACCATGTGAAGCTGCCCCTGGG + Intronic
1132311315 15:100860006-100860028 CACCCAGCTAAGCTGCTCCCGGG + Intergenic
1133325924 16:4942308-4942330 CACCCTGTGAAGTTGATGCTAGG - Intronic
1133342386 16:5045120-5045142 CATCCTGTCCAGCTCCTGCCTGG + Intronic
1133466717 16:6034492-6034514 CACCATATGAAGATGCAGCCAGG - Intronic
1134216046 16:12317649-12317671 GTCCCTGTGAAGCTGATGTCAGG - Intronic
1134652130 16:15917842-15917864 CAACCTGTGATGCTGCAGCCTGG + Intergenic
1135038663 16:19100142-19100164 CACTCAGTGAAGCTGCTTCTAGG - Intergenic
1135222232 16:20623105-20623127 AACCCTGAGATGCTGGTGCCAGG + Intronic
1135545408 16:23362629-23362651 CACCCAGAGAGGCTGCTCCCAGG - Intronic
1136190277 16:28611249-28611271 CCTCATGTGAAACTGCTGCCTGG - Intronic
1136855093 16:33649046-33649068 CACCTTGACAAGCTGTTGCCAGG + Intergenic
1137257775 16:46791066-46791088 CACTCTGTGAAGCTGCTATAGGG + Intergenic
1138444601 16:57055425-57055447 CAGCCTGTGAACCTGCTGGACGG - Exonic
1139852517 16:69959667-69959689 CACCCAGGGAGGCTCCTGCCCGG + Intronic
1139881488 16:70182575-70182597 CACCCAGGGAGGCTCCTGCCCGG + Intronic
1139911130 16:70398373-70398395 CACCGGGTGAAGCTGGTGCCCGG - Exonic
1140757507 16:78081464-78081486 CGTCCTGTGGACCTGCTGCCTGG + Intergenic
1140759243 16:78096517-78096539 CACCATGTGAACCTCCTGACAGG + Intergenic
1203116675 16_KI270728v1_random:1497530-1497552 CACCTTGACAAGCTGTTGCCAGG + Intergenic
1142495520 17:304578-304600 CACTCTGAGCAGCTGGTGCCTGG + Intronic
1142593338 17:1017371-1017393 CACCCTGTGTGGCTACTGCTGGG - Intronic
1143347084 17:6257754-6257776 CCCCCTTGGAGGCTGCTGCCAGG + Intergenic
1144250101 17:13407751-13407773 CACCCTCTGTGGCTGCTGGCAGG + Intergenic
1145201027 17:20944801-20944823 CACCACGTGTGGCTGCTGCCGGG + Intergenic
1145879782 17:28344668-28344690 CACCCCATGCTGCTGCTGCCTGG + Exonic
1147582620 17:41635816-41635838 CAGCCTGTGAAGGTGCTGGGCGG + Intergenic
1148330570 17:46811603-46811625 CACCCTGTCCTGCTGCTGCCTGG - Intronic
1149225521 17:54465626-54465648 CGACCTGTGAGGCTGCAGCCTGG - Intergenic
1149435303 17:56628879-56628901 CACCCTCTGAAGCTCCTGTCTGG + Intergenic
1150350182 17:64438260-64438282 CACCCTCTGAAGCAACAGCCTGG + Intergenic
1150613029 17:66748971-66748993 CACCCTCTGAAGATGCAGACTGG - Intronic
1150613048 17:66749051-66749073 CACCCTCTGAAGATGCAGACTGG - Intronic
1150613066 17:66749131-66749153 CACCCTCTGAAGATGCAGACTGG - Intronic
1152718150 17:81909707-81909729 CGCTCTGAGAAGCTGCTGCTGGG + Intronic
1152780672 17:82226248-82226270 CGTCCTGTGAAGCTGCTCACTGG + Intergenic
1156421626 18:36960226-36960248 CAACCTATGAGGCTGCAGCCCGG + Intronic
1160735165 19:659035-659057 CACCCTGTGAACATGGAGCCTGG - Intronic
1161155468 19:2730291-2730313 CACCCTGGGGAGCTGATGGCTGG + Intronic
1161768192 19:6218118-6218140 CACTCAGCGTAGCTGCTGCCAGG - Intronic
1162020139 19:7864559-7864581 CTCGCTGGGAAGCTCCTGCCTGG - Intronic
1162839963 19:13349240-13349262 CACAATGTAAAGCTGATGCCAGG + Intronic
1163271368 19:16256177-16256199 CTCTCTGTGTGGCTGCTGCCAGG + Intergenic
1163321497 19:16577398-16577420 CAGCCTGTCCAGCCGCTGCCCGG + Exonic
1163428020 19:17249820-17249842 CTCCCTGGGAAGGGGCTGCCAGG + Exonic
1165434652 19:35789341-35789363 CACACTGGGAGGCTGCTGGCAGG - Intergenic
1165447723 19:35865806-35865828 CACCCTGTGTTGCTGCTACAAGG - Intronic
1165900725 19:39168057-39168079 CACCCTGGGCAGCTGCTGCATGG + Intronic
1168351979 19:55681083-55681105 CACCCTGTGGCCCTGCTGGCTGG + Intronic
925020098 2:562494-562516 GACCCTGTGGGGCTGCTGCATGG + Intergenic
926056853 2:9778800-9778822 CACCCGCTGAAGCCCCTGCCTGG + Intergenic
926307352 2:11648030-11648052 CTCCCTCTGCAGCTGCAGCCTGG + Intergenic
926497096 2:13604175-13604197 CACCTTGGGACGTTGCTGCCGGG - Intergenic
926829316 2:16943368-16943390 CTCCCTGTGGAGCTACTGCCTGG - Intergenic
927206633 2:20615297-20615319 CATCCTGTGAAGCAGCAGCCAGG - Intronic
927677543 2:25117330-25117352 CGCCCTGTGACTCTGCTGTCTGG + Intronic
928462653 2:31489479-31489501 CAACCTGTGATGCTGCAGCTTGG + Intergenic
929358112 2:41050729-41050751 CACCCCATGAAGTTGCGGCCTGG - Intergenic
929367058 2:41171615-41171637 TCCGCTGTGAAGATGCTGCCAGG - Intergenic
931919194 2:66994545-66994567 CATTCTGTGAATATGCTGCCAGG + Intergenic
931971245 2:67589322-67589344 CAACCTGTGAGGCAGCAGCCTGG + Intergenic
936514907 2:113175190-113175212 GACCCAGTACAGCTGCTGCCTGG - Intronic
938551430 2:132385985-132386007 CACCTTGTGAAGTAGCTGCCAGG + Intergenic
939759346 2:146155107-146155129 CGCCCTGTGAAGAAGGTGCCTGG - Intergenic
941162561 2:162052400-162052422 CACCATGTGGGGATGCTGCCTGG + Intronic
942065801 2:172270459-172270481 CAACCTGTGAGGCTGCAGCCTGG - Intergenic
942115431 2:172724655-172724677 CACCCCATGAAGCTGCACCCAGG + Intergenic
943395541 2:187328687-187328709 CACCCTCTGAAGCCACAGCCTGG - Intergenic
946663953 2:222030080-222030102 CGCCCTGTGAAGGTACTGACAGG + Intergenic
947974715 2:234355678-234355700 CACCCTGGAAAGCAGCAGCCAGG - Intergenic
948565211 2:238881924-238881946 CACTCTGTGAAGGGACTGCCTGG + Intronic
948598421 2:239095195-239095217 CACCCTGTGGCCCTGCTGCAGGG + Intronic
1169870161 20:10240979-10241001 GCCTCTGTGAAGCAGCTGCCAGG + Intronic
1170186184 20:13593619-13593641 CAACCTGCGAGGCTGCAGCCTGG + Intronic
1170668255 20:18405838-18405860 CATCCTGTATAGCTGCTGCTGGG - Intronic
1170781677 20:19431080-19431102 CACCCTGGGAAGATGCTAACTGG + Intronic
1171074780 20:22111640-22111662 CACCTTGTGAAGAAGGTGCCTGG - Intergenic
1171096843 20:22340378-22340400 TACCCTGTGAAGCAGCAGGCAGG + Intergenic
1171420669 20:25015184-25015206 CACCCTGTGAAGCCACTCCCAGG + Exonic
1171472714 20:25384833-25384855 CACCCTGTCCTGTTGCTGCCTGG - Intronic
1173202181 20:40962219-40962241 CAACCTTTGGAGCTGCAGCCTGG - Intergenic
1173240023 20:41286929-41286951 CACCTTGTGAAGATAGTGCCTGG + Intronic
1173861041 20:46283740-46283762 CTCCATGTGAAGCTGCTCTCTGG - Intronic
1174114157 20:48215438-48215460 CACCATTTGAAGCTCCTCCCAGG - Intergenic
1175227009 20:57450577-57450599 CACTCTGTGTGGCTGCAGCCTGG + Intergenic
1175697155 20:61111169-61111191 CTCCCTGAGGAGCGGCTGCCTGG - Intergenic
1175833340 20:61978777-61978799 CACGCTGAGAAACTGATGCCAGG + Intronic
1175965812 20:62659702-62659724 CACCCTGCAAGGCTGCAGCCAGG - Intronic
1176073593 20:63238728-63238750 CAGGGTGTGACGCTGCTGCCTGG + Intronic
1176136005 20:63522292-63522314 CACGCTGTGAGGCTGTTGCTGGG + Intergenic
1176177080 20:63733783-63733805 CACCCTGAGAGGCTCCTGGCCGG + Intronic
1176216531 20:63950783-63950805 CACCCTGAGATCCTGATGCCAGG + Intronic
1176368793 21:6050083-6050105 CATCCTGTGACTCTGCTGCTGGG - Intergenic
1178822719 21:35990329-35990351 CTCCCTCTGAACTTGCTGCCTGG - Intronic
1179754726 21:43488459-43488481 CATCCTGTGACTCTGCTGCTGGG + Intergenic
1179878928 21:44285512-44285534 CACCCTGGGCAGCCCCTGCCAGG + Intergenic
1180383469 22:12162734-12162756 GCCCCTGTGCAGCTGCTGCAGGG + Intergenic
1180757586 22:18173375-18173397 CACACTGTGATCCTGCTGTCTGG + Intronic
1180793797 22:18592104-18592126 CACCCTGTGGTGCTTTTGCCGGG + Intergenic
1180799784 22:18626355-18626377 CACCTTGAGAAGCTGCAGCTGGG - Intergenic
1180870610 22:19144665-19144687 CACCCTGTGACGCGCCTGCTGGG - Exonic
1181026514 22:20130781-20130803 CACCCTGAGGAGCTGCGGCCGGG + Intronic
1181074189 22:20364070-20364092 CACACTGTGATCCTGCTGTCTGG - Intronic
1181221931 22:21368911-21368933 CACCTTGAGAAGCTGCAGCTGGG + Intergenic
1181227943 22:21403216-21403238 CACCCTGTGGTGCTTTTGCCGGG - Intergenic
1181250710 22:21531623-21531645 CACCCTGTGGTGCTTTTGCCGGG + Intergenic
1181637322 22:24180550-24180572 CACCTTGAGAAGCTGCAGCTGGG + Intergenic
1182050018 22:27305515-27305537 CACCTTGAGAAGCTGTTGCCTGG + Intergenic
1182148934 22:28014938-28014960 CCCACTCTGCAGCTGCTGCCTGG - Intronic
1182338560 22:29601678-29601700 CACCCAGTGAGGCTGCTGTGGGG - Intergenic
1183172359 22:36197746-36197768 CATTATGTGAACCTGCTGCCTGG - Intronic
1183382657 22:37498196-37498218 CATCCTGGGAAGCAGCTCCCAGG + Intronic
1183420203 22:37707434-37707456 CACCCTCAGATGCTGCTGCTGGG + Intronic
1184147654 22:42620686-42620708 CACGCTGTGAAGGTCCTGACGGG + Intronic
1185239289 22:49734054-49734076 CACCCTGGGAAGCTCTTCCCGGG + Intergenic
949965173 3:9349546-9349568 CAGCCTGTTAAGCCACTGCCTGG + Intronic
951551880 3:23882755-23882777 CACCCTCTGCAGCTGCTGGCTGG + Intronic
952219320 3:31308857-31308879 CATCCTGTGATGCTACTACCTGG - Intergenic
953254666 3:41278211-41278233 CAACCTGTAAGGCTGCAGCCCGG + Intronic
956438822 3:69260415-69260437 CACCCTCCGCAGCTGCTGGCTGG - Intronic
956761364 3:72447421-72447443 CGCCCCGTGAGGCTGTTGCCGGG + Intergenic
957587851 3:82155650-82155672 CTCCCTGTGAAGCAGCTGAAAGG - Intergenic
957917857 3:86709092-86709114 CAACCTGGGAAGCTGCAGCCTGG - Intergenic
958588152 3:96118018-96118040 TACCCTCTGAAGCAACTGCCTGG - Intergenic
960065397 3:113366978-113367000 CAACCTGTGAGGCTGCAGCCCGG + Intronic
960479545 3:118171537-118171559 CACCCTCTGCAGCTGCTGGCCGG - Intergenic
961832040 3:129627856-129627878 CAACCTGGGAAGCTGAGGCCCGG - Intergenic
962000452 3:131289718-131289740 CAAGCTGTGATGCTGCTGGCAGG - Intronic
962291456 3:134140269-134140291 CAACCTGTGAGGCTGCAGCCTGG + Intronic
964055109 3:152445497-152445519 CAGCCTGTGCAGCTGCAGCCTGG - Exonic
965034655 3:163423056-163423078 CAGCTTGTGAAAATGCTGCCAGG - Intergenic
966141819 3:176766247-176766269 CACCCTGTGTAGCAGCTGCATGG + Intergenic
967126379 3:186428081-186428103 CACTCTGTGGACCTGCAGCCAGG + Intergenic
967829317 3:193905125-193905147 CACATTTTGAAGCTGCAGCCAGG + Intergenic
968079635 3:195836992-195837014 CATCCTGGGAGGCTGCTCCCAGG - Intergenic
968408610 4:365050-365072 CCCCCTGCCAGGCTGCTGCCTGG + Intronic
968565041 4:1307651-1307673 GACCCTGGGAAGCTGGTGCGTGG + Intronic
969301503 4:6299998-6300020 GACCCTGAGAAGCAGCTGCCAGG - Intronic
970511437 4:16785544-16785566 CACCCGATGCGGCTGCTGCCCGG - Intronic
971184842 4:24364418-24364440 CTTCCTGTCAAGCTGCTTCCAGG + Intergenic
971335559 4:25720576-25720598 TTCCCTTTGAAGCCGCTGCCTGG - Intergenic
972196181 4:36656417-36656439 CAACCTGTGAGGCTGCAGCCTGG + Intergenic
974672182 4:65046581-65046603 CACCCTGTGGCTCTGCTGCTTGG - Intergenic
974877524 4:67716851-67716873 CAGGGTTTGAAGCTGCTGCCGGG - Intergenic
975528747 4:75378625-75378647 CCCCCTGCCAGGCTGCTGCCTGG - Intergenic
976260316 4:83139158-83139180 AACCCTGTCATTCTGCTGCCAGG - Intergenic
976482833 4:85564607-85564629 CACCCCGTGAAACTGGTCCCTGG - Intronic
976762898 4:88569315-88569337 CACACTATGAAGCTGCTACCTGG + Intronic
977829719 4:101576467-101576489 CGACCTGTGAGGCTGCAGCCTGG + Intronic
978928948 4:114287428-114287450 CATTCTGTGAGGCTGCAGCCTGG + Intergenic
979017465 4:115452435-115452457 CAACCTGTGAGACTGCAGCCTGG - Intergenic
979272862 4:118782828-118782850 CAACCTGTGAGGCAGCAGCCTGG - Intronic
980558729 4:134442873-134442895 CCACCTGTGAGGCTGCAGCCTGG - Intergenic
981288247 4:143045126-143045148 CACCCTGTGGTTCTGCGGCCTGG + Intergenic
982070664 4:151691752-151691774 CACCCTGTGAAGCTGACGATAGG + Intronic
982660294 4:158198804-158198826 CACCCTGTGAATCCACTGACTGG + Intergenic
983469319 4:168137012-168137034 CACCCTCTGGAGCAGCAGCCTGG + Intronic
985324706 4:188754640-188754662 CCCCCTCTGCAGCTGCTGGCTGG - Intergenic
985511474 5:316385-316407 CATCCTGTGGATCAGCTGCCGGG + Intronic
986384432 5:7217799-7217821 CACCCAGAGGAGCTGCAGCCTGG - Intergenic
987848358 5:23317243-23317265 AACCTAGTGAAGCTGCTTCCAGG + Intergenic
990982622 5:61615590-61615612 CAGCCTGGGAAGCCACTGCCTGG + Intergenic
991169486 5:63604349-63604371 CACACCCTGAAGCTGCTGCTGGG + Intergenic
992182050 5:74207121-74207143 CAGCATGTGCAGCTCCTGCCTGG + Intergenic
995742522 5:115369519-115369541 CTCCCTGTGAGGCTGCAGCTGGG - Intergenic
996855283 5:127998913-127998935 CACCCAGTTAAGCTGCTCCTGGG + Intergenic
997607349 5:135184745-135184767 CACACTGAGAAACTGCTGTCAGG - Intronic
1001333222 5:170777019-170777041 CACCGTGGGAAGCTGCTTCCAGG - Intronic
1001361511 5:171090772-171090794 CACCCTCTGAAGCAACAGCCCGG - Intronic
1001956787 5:175853317-175853339 CACCGTGTGAGGCTGTTGCCAGG - Intronic
1002468785 5:179422361-179422383 TAGCCTGGGAAGGTGCTGCCAGG - Intergenic
1004509140 6:16270485-16270507 CACCCTGACCAGCTGCTTCCTGG + Intronic
1005250169 6:23936480-23936502 CAGCCTGTGTAGCTGCTGTTCGG - Intergenic
1005380650 6:25231302-25231324 CACCCAGGGAAGTTGCTGACAGG - Intergenic
1006124308 6:31827745-31827767 CAGCCTGAGGAGCTGCTGCGAGG + Exonic
1006305379 6:33215351-33215373 CACCCTGGGAAGCTGCTCACAGG + Intergenic
1007165932 6:39829118-39829140 CATCCCGTGAAGCTGGTCCCTGG - Intronic
1008057029 6:46955818-46955840 CACACTTGGAAGCTGCTGCAAGG + Intergenic
1010997663 6:82551730-82551752 CAACCTGCGACGCTGCAGCCTGG - Intergenic
1011288612 6:85752048-85752070 CAACTTGTGAGGCTGCAGCCTGG + Intergenic
1011417753 6:87140083-87140105 GCCCCTGCCAAGCTGCTGCCTGG - Intergenic
1011884626 6:92078679-92078701 CAACCTGTGAGGCAGCAGCCTGG + Intergenic
1013578310 6:111507449-111507471 CAACCTGCGAGGCTGCAGCCTGG - Intergenic
1014692321 6:124577352-124577374 CACACTATGCAGCTGCTGCTGGG - Intronic
1014761576 6:125363153-125363175 CACACTGAGAAGCTCCTGCCTGG + Intergenic
1016584921 6:145673693-145673715 CAACCTGAGAGGCTGCAGCCTGG + Intronic
1017949965 6:159128166-159128188 CTCCCTGTGAACCTCCTGCGGGG + Intergenic
1018325171 6:162659971-162659993 AACCCTGTGAAACTTATGCCAGG + Intronic
1018390098 6:163335553-163335575 CACTCTGGGAAGCTGCGGCCAGG + Intergenic
1019176737 6:170163166-170163188 CACCGACTGATGCTGCTGCCTGG + Intergenic
1019636635 7:2079453-2079475 CAGGCTCTGAAGCTGCAGCCTGG + Intronic
1021870553 7:25001998-25002020 CAACCTATGAGGCTGCAGCCTGG - Intergenic
1022745375 7:33166586-33166608 CAACCTGTGAGGCAGCAGCCTGG - Intronic
1023892222 7:44401112-44401134 CTCCCTGTCAAGCAGCTGCCAGG - Intronic
1025024207 7:55503130-55503152 CACTCTGAGCAGCTGCTGACAGG + Intronic
1028140039 7:87263573-87263595 CAACCTGTGACACTGCAGCCTGG - Intergenic
1028621142 7:92830926-92830948 CTCCCTGTGAAGCTGCTCCATGG + Intronic
1028727176 7:94101034-94101056 CCCCCTCTGCAGCTGCTGGCTGG - Intergenic
1029846374 7:103416300-103416322 CCCCCAGTGAAGATGCTGGCTGG - Intronic
1030868802 7:114731779-114731801 CAGCCTGTGAAGCAGCTGAGAGG + Intergenic
1030936751 7:115594208-115594230 CGACCTGTGAGGCTGCAGCCTGG + Intergenic
1031365974 7:120901135-120901157 CAACCTGTGAGGCAGCAGCCTGG + Intergenic
1032784840 7:135192849-135192871 CAGCCTGTGAACTTGCTCCCAGG - Intronic
1033526827 7:142224321-142224343 CACCATGAGATTCTGCTGCCAGG + Intergenic
1033875289 7:145810310-145810332 CATGCTGTGAGGCTGATGCCAGG - Intergenic
1034555483 7:151847801-151847823 CACCCTGTGAGGTTGGCGCCCGG + Intronic
1034618301 7:152436715-152436737 CCCCCTGTGACGCGGCGGCCGGG + Intergenic
1035673346 8:1436946-1436968 CACGCTGTGCAGGTGCAGCCTGG + Intergenic
1036017106 8:4797151-4797173 GAGCCTGAGATGCTGCTGCCTGG - Intronic
1036391538 8:8328294-8328316 CATCCGGTGAAGAGGCTGCCCGG + Exonic
1036778007 8:11626801-11626823 CACCTTGTAAAACGGCTGCCTGG - Intergenic
1036798928 8:11775309-11775331 TACCCTCTGAAGCAGCAGCCTGG + Intronic
1037510642 8:19578385-19578407 CCACCTGTGATCCTGCTGCCTGG + Intronic
1037755242 8:21706126-21706148 CACCCTGGGAAGCTGCAGGGAGG - Intronic
1038729153 8:30111795-30111817 CATCCTGTGACCCTGCTGGCTGG - Intronic
1039475261 8:37836266-37836288 CTGCCTGTGCAGCAGCTGCCTGG - Intronic
1040276455 8:46016446-46016468 GACCCTGTGCAGGAGCTGCCAGG + Intergenic
1040276701 8:46017529-46017551 CACCCTGTGCAGGTGCTGCTGGG + Intergenic
1041076055 8:54171085-54171107 CTCCCTGTGCACCTGCCGCCTGG + Intergenic
1041221551 8:55656549-55656571 CCCCCTGCCAGGCTGCTGCCTGG - Intergenic
1041929997 8:63276364-63276386 CATCCTGTGAAACCGGTGCCTGG + Intergenic
1042532498 8:69830702-69830724 TACCCTCTGCAACTGCTGCCTGG + Intronic
1042819687 8:72916477-72916499 CACCCTCAGATGCTGCTGCAGGG - Intronic
1043625233 8:82248879-82248901 CACCTTGTGAAGCAGGTGCCTGG + Intergenic
1043938867 8:86174111-86174133 CAACCTGTGAGGCAGCAGCCTGG - Intergenic
1046818993 8:118616155-118616177 CACACAATGAAGCTGCTGCAGGG + Intronic
1047515108 8:125547121-125547143 CACTCTGTGAAGATACAGCCTGG + Intergenic
1047583454 8:126242575-126242597 GAACCTGTGCAGCTGCTGCCTGG - Intergenic
1049276368 8:141722027-141722049 CACCCTCAGAAGCTGCTTCAGGG - Intergenic
1049424831 8:142533298-142533320 CTCCCTGTGGAGCTCCTGCGTGG + Exonic
1049610586 8:143553084-143553106 CCCCCTCGGGAGCTGCTGCCAGG + Intergenic
1049796605 8:144499960-144499982 CACCCTGTCCACCTGCTGCTGGG - Intronic
1049944508 9:580990-581012 CACCCTCCGCAGCTGCTGGCTGG + Intronic
1050667259 9:7953654-7953676 CACCTTGTGAAGATGTAGCCAGG + Intergenic
1051344083 9:16136963-16136985 GACCCTGGGAAGCAGCTGCCTGG - Intergenic
1052231568 9:26160706-26160728 CACTCTGTGAAAATCCTGCCAGG + Intergenic
1053290898 9:36879134-36879156 GCCCCTGTCCAGCTGCTGCCAGG + Intronic
1055925621 9:81507514-81507536 CACCCTCCGCAGCTGCTGGCCGG - Intergenic
1056668079 9:88597712-88597734 CAACCTGTGAGGCTGCAGCCTGG + Intergenic
1057118164 9:92545390-92545412 CACCCTCCGCAGCTGCTGGCCGG - Intronic
1057227846 9:93301912-93301934 CACACTCTGAAGTTGCTGGCCGG + Intronic
1057267835 9:93630665-93630687 CACCCTGTGCAGGTTCAGCCAGG + Intronic
1058614320 9:106809575-106809597 CAACCTGTGAGGCAGCAGCCTGG + Intergenic
1058672558 9:107372328-107372350 CTCTCTGTGAAGCTGATGCCTGG - Intergenic
1059729682 9:117044457-117044479 CCCACTGTGAAGTTTCTGCCAGG - Intronic
1060406737 9:123376555-123376577 CACCCTGCTTAGCTCCTGCCGGG + Intronic
1060659368 9:125394852-125394874 CACCCTGTGAAGAAGGGGCCTGG + Intergenic
1060996796 9:127878573-127878595 CACCATCTGGGGCTGCTGCCTGG - Intergenic
1061513093 9:131072687-131072709 CAGCCTCTGCAGCTGCTCCCGGG - Exonic
1062316571 9:135970241-135970263 CACCCTGGGAAGCTGCTCCCAGG - Intergenic
1062444448 9:136587809-136587831 CACCCTGAGACCCTGCTCCCGGG - Intergenic
1185786763 X:2897621-2897643 GACCCTGGGAAGCTCCTGCCCGG - Intergenic
1187654964 X:21461644-21461666 CAACCTATGAAACTACTGCCAGG - Intronic
1188501709 X:30834048-30834070 AACCATCTGCAGCTGCTGCCTGG + Exonic
1189601411 X:42630512-42630534 GACCCTGTGACCCTGCTTCCTGG - Intergenic
1191073719 X:56429804-56429826 CAACCTGTGAGGCTGCAGCGTGG - Intergenic
1195808372 X:108801219-108801241 CAACCTGTGAAGCTGCAGCCTGG + Intergenic
1196012510 X:110904055-110904077 CGACCTGTGAAGCTGCAGGCTGG - Intergenic
1197294940 X:124707431-124707453 AATCATGTGAAACTGCTGCCTGG - Intronic
1197709288 X:129654410-129654432 CGCTCTGTCAATCTGCTGCCTGG + Intronic
1198256134 X:134925785-134925807 CACCCTCCGCAGCTGCTGGCCGG - Intergenic
1198859682 X:141055885-141055907 CACCCTGGGTAGCAGCTGCATGG - Intergenic
1198903011 X:141531505-141531527 CACCCTGGGTAGCAGCTGCATGG + Intergenic
1199593451 X:149488715-149488737 CAGCCTGTGCTGCTGCAGCCAGG + Intronic
1199598566 X:149526716-149526738 CAGCCTGTGCTGCTGCAGCCAGG - Intronic
1199968514 X:152841031-152841053 CCACCTGTGAGGCTGCAGCCTGG - Intronic
1199981567 X:152923407-152923429 CACCCTGGCAGTCTGCTGCCTGG - Intronic
1200254035 X:154569748-154569770 GAGCCTGCGAAGCAGCTGCCAGG - Intergenic
1200263734 X:154634660-154634682 GAGCCTGCGAAGCAGCTGCCAGG + Intergenic
1201287629 Y:12392583-12392605 GACCCTGGGAAGCTCGTGCCCGG + Intergenic
1201459495 Y:14206585-14206607 CATCCTGTGAGACTGCAGCCTGG + Intergenic
1201618005 Y:15923243-15923265 TACCCTTTGAAGCTGATGGCTGG + Intergenic