ID: 1097801106

View in Genome Browser
Species Human (GRCh38)
Location 12:63915418-63915440
Sequence CAGAGGAACCAAAAGAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 324}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097801100_1097801106 -6 Left 1097801100 12:63915401-63915423 CCAAATAAAAGCATTTCCAGAGG 0: 1
1: 0
2: 1
3: 21
4: 254
Right 1097801106 12:63915418-63915440 CAGAGGAACCAAAAGAATGGGGG 0: 1
1: 0
2: 1
3: 26
4: 324
1097801099_1097801106 8 Left 1097801099 12:63915387-63915409 CCAAATGTTATAATCCAAATAAA 0: 1
1: 0
2: 2
3: 54
4: 538
Right 1097801106 12:63915418-63915440 CAGAGGAACCAAAAGAATGGGGG 0: 1
1: 0
2: 1
3: 26
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097801106 Original CRISPR CAGAGGAACCAAAAGAATGG GGG Intronic
900687957 1:3960965-3960987 CACAAGAGCCAAAAGAAAGGCGG + Intergenic
901600033 1:10416484-10416506 CACAGCAACCAGAAGAAAGGTGG - Intronic
901632147 1:10653204-10653226 CATAGAAACCAACAGGATGGGGG + Intronic
902894368 1:19468707-19468729 CAGAGGAGCCAGAAGAGTGAGGG - Intronic
903467447 1:23561753-23561775 TAGAGGAAGGAAAAGAAGGGAGG - Intergenic
905809219 1:40899634-40899656 AAGACGCACCCAAAGAATGGGGG + Intergenic
905902756 1:41592634-41592656 CAGAGAAGCCAAGAGGATGGTGG - Intronic
908709476 1:66998795-66998817 CATAGAAACATAAAGAATGGTGG + Intergenic
909581972 1:77246791-77246813 CAGAAGGACCAAAAGAGAGGTGG + Intergenic
911413906 1:97546611-97546633 CTGAGGAAAAACAAGAATGGTGG + Intronic
912628232 1:111223693-111223715 CAGTGGTACAGAAAGAATGGAGG - Intronic
912909556 1:113744286-113744308 AAGAGGAACAAAAACACTGGAGG + Intronic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
912986279 1:114435604-114435626 AAGAGGTACAAGAAGAATGGAGG + Intronic
914522484 1:148430302-148430324 AAGAGAAACAAAGAGAATGGTGG + Intergenic
918760224 1:188394970-188394992 AAGAGGAAAGAAAAGAATAGTGG - Intergenic
919170586 1:193948984-193949006 CAGAGAAACAGAAATAATGGCGG + Intergenic
919513257 1:198492875-198492897 GAGAAGAATCAAAAGAATGATGG - Intergenic
921854978 1:219972663-219972685 CAGAGGCACCAGAAGATTAGTGG - Intronic
922919841 1:229293227-229293249 CAAAAAAACCAAAAGGATGGGGG - Intronic
924070873 1:240277057-240277079 CAGAGGAACATAAACAATAGCGG + Intronic
1064943909 10:20767249-20767271 GAGAGGAACCAGAAGATTGATGG - Intergenic
1066049940 10:31624081-31624103 CAGAGAAACTAAAAGAATCTAGG - Intergenic
1066224680 10:33370600-33370622 CAGAGGAAACAAGAGAGGGGAGG - Intergenic
1066431890 10:35359807-35359829 TTTAGGCACCAAAAGAATGGTGG - Intronic
1068030634 10:51700213-51700235 TATAGGAAGCAACAGAATGGGGG - Intronic
1068538086 10:58262909-58262931 CAGAGGGAGTGAAAGAATGGGGG + Intronic
1070443854 10:76475137-76475159 CATAGAGACCAAAAGAATAGTGG + Intronic
1071490597 10:86133996-86134018 CAGAGGAAACAAAAGGAAAGAGG + Intronic
1071767516 10:88684780-88684802 CAGAGAAACCAAATGAATACAGG - Intergenic
1073302068 10:102476890-102476912 CAGAGAAACCACTAGAAGGGTGG - Exonic
1073318415 10:102599150-102599172 CACAGGAAAGAAAAGGATGGTGG + Intronic
1075934435 10:126327357-126327379 CATGGGAACCTAAAGAAAGGGGG - Intronic
1078961072 11:16272289-16272311 CACAGAAACCAAAAAAAGGGGGG + Intronic
1079653226 11:22957274-22957296 CATAGGAACCAAAAATGTGGTGG + Intergenic
1080285982 11:30612738-30612760 AAGAGGAAACAAAAGAAAGAAGG - Intergenic
1080524665 11:33102804-33102826 CAGATGAACCCAAATAATAGAGG + Intronic
1080577036 11:33609412-33609434 CAGAGGAACCAAAAGGGTATAGG + Intronic
1081280069 11:41198620-41198642 GAGAGGAAAAAAAAGTATGGAGG + Intronic
1081792871 11:45801379-45801401 AAGAGGAAGAAAAAGCATGGAGG + Intergenic
1081909015 11:46688295-46688317 AAGGGGAACCAAAAGAAGTGGGG + Intronic
1083224259 11:61274625-61274647 CAGAGGCAGCTAAAGAAAGGGGG + Intronic
1084286028 11:68131350-68131372 CAAACGAACAAAAAGAATTGTGG + Intergenic
1085028005 11:73249845-73249867 CTGAGGAACAAGAAGAATGCTGG + Intergenic
1085335278 11:75688472-75688494 GAGAGGAACGAAAAGCAGGGTGG - Intergenic
1088072932 11:105812184-105812206 CAGAGAAAACAAAGGAATGCTGG - Intronic
1088657419 11:112013953-112013975 GAGAGGAAGCAAGAGAGTGGAGG + Intronic
1089930333 11:122303675-122303697 GAGAGGACCCAAAGGAATGGGGG + Intergenic
1090703242 11:129314820-129314842 CAAAGAAAGCAAAAGAAAGGAGG - Intergenic
1091012982 11:132023289-132023311 GAGAGGAGCCAAAATAATGTTGG + Intronic
1092314814 12:7399423-7399445 AAGAGGAAGAAGAAGAATGGGGG - Intronic
1093888893 12:24495789-24495811 CAAAAGAACCACAAGGATGGGGG + Intergenic
1095207227 12:39452465-39452487 CAGATGGAGGAAAAGAATGGTGG - Intergenic
1095592173 12:43915698-43915720 AAGAGGAAGAAAAAGAAAGGAGG + Intronic
1095995587 12:48081005-48081027 CAGAGGAGGCAAAAGAAGGAAGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097739467 12:63222604-63222626 CAGCGGAACCAAAATAAAGAAGG + Intergenic
1097801106 12:63915418-63915440 CAGAGGAACCAAAAGAATGGGGG + Intronic
1098194053 12:67980833-67980855 AAGAGGCACCAGAATAATGGTGG + Intergenic
1098655541 12:73024642-73024664 CAGAATACCCAAAAGAATGAAGG + Intergenic
1098989817 12:77052871-77052893 CAGAGGAGCAAAAAACATGGTGG + Intronic
1099097950 12:78399262-78399284 CAGAGGAACTGATAGAATAGTGG - Intergenic
1099324678 12:81199638-81199660 CCTAGGGACCAAGAGAATGGTGG - Intronic
1099664524 12:85610836-85610858 CAGAGTCTCCAAAAGAATTGTGG + Intergenic
1099863873 12:88254186-88254208 CAAACAAACAAAAAGAATGGAGG - Intergenic
1100330737 12:93579540-93579562 CAGCAGAAGCAAAGGAATGGAGG - Intronic
1100572707 12:95858337-95858359 CAGGCGAAGCAAAAGAAAGGTGG + Intergenic
1100755441 12:97746259-97746281 CAGAAGGACCCAAAGAATAGAGG + Intergenic
1101063031 12:100991063-100991085 CAGTGGGACCAAGAGAATAGAGG + Intronic
1102300148 12:111765895-111765917 CAGAGGAAGAAAAGGCATGGGGG - Intronic
1103139755 12:118538214-118538236 CCTAGGAACCAAGAGAATGAAGG - Intergenic
1103508576 12:121457866-121457888 CAGAGGAACTCAAATATTGGTGG - Intronic
1103976896 12:124708532-124708554 CACAGAACCCAAAATAATGGTGG - Intergenic
1104934535 12:132357490-132357512 CATGGGAACCAAATGAACGGGGG + Intergenic
1108209533 13:48124405-48124427 CAGAGGAATCAGAAGAAAGGTGG - Intergenic
1108230571 13:48335913-48335935 CTGAGGAAAAAAGAGAATGGTGG + Intronic
1108365180 13:49703843-49703865 CTAATAAACCAAAAGAATGGGGG + Intronic
1109178303 13:59182448-59182470 CAGAGGAAAAAAAAGCATGAAGG - Intergenic
1110338136 13:74356544-74356566 CACAGGATACAAAAGAATGCAGG - Intergenic
1110513241 13:76378506-76378528 TAGTGGAGCCAAAAGAATGGAGG + Intergenic
1111328021 13:86724699-86724721 CTGAGGAAGAAAAACAATGGAGG + Intergenic
1111656360 13:91158901-91158923 CAGTGAAACCAAAAGAATACAGG - Intergenic
1112307047 13:98284271-98284293 CAGGGAAACCAAAAGATTGTTGG + Intronic
1112699810 13:101993761-101993783 CAGAGAAGGCAAAAAAATGGAGG + Intronic
1113062648 13:106339966-106339988 CAGAGGATACAAACGAAGGGAGG + Intergenic
1114193340 14:20457221-20457243 AAGGGGAACAAAAAGAATGCTGG + Exonic
1114999951 14:28410094-28410116 CAGAAGAAAAAAAAGAAAGGAGG + Intergenic
1118321716 14:64757362-64757384 AAGAGGAAACAGAAGAAAGGTGG - Intronic
1118489781 14:66247806-66247828 GAGAGGGACCCAAACAATGGTGG - Intergenic
1120549571 14:85853166-85853188 CAGTGGTACAAAAATAATGGTGG - Intergenic
1121672432 14:95723023-95723045 GAGAGGAAGCAAGAGATTGGGGG - Intergenic
1122874442 14:104657116-104657138 GAGGGGAACCAAAAGCATGTGGG + Intergenic
1124643731 15:31419618-31419640 CACAGGAACAAAAAGAATAAAGG + Intronic
1124725234 15:32150680-32150702 CAAAGGAACTAAAATATTGGAGG + Intronic
1125422369 15:39517600-39517622 CAGAGGAACCAACATCCTGGAGG + Intergenic
1125701139 15:41685414-41685436 CAGGACAACCAAAATAATGGGGG - Intronic
1125766012 15:42137072-42137094 AAGAGGAACCACCAGAATGGTGG + Intergenic
1126175445 15:45731117-45731139 CAGAGGAACCACAGCACTGGGGG + Intergenic
1130330154 15:82916134-82916156 CAGAGGAAACAAAATAATGGGGG + Intronic
1130840064 15:87690617-87690639 CAGAATAACCAAAAGAATCTTGG + Intergenic
1130861821 15:87897860-87897882 TAGAGGATCCAAAAGAACGAAGG + Intronic
1131111925 15:89769956-89769978 CAGGGGAACCAAATGAAGGGTGG + Intronic
1132544851 16:528261-528283 CAGAGGAACCCAGAGGAAGGCGG + Intronic
1132930710 16:2457807-2457829 CAGGTGAACCTAAATAATGGTGG - Exonic
1134757617 16:16682241-16682263 CAAATGAACCAGAAGAAAGGAGG - Intergenic
1137436773 16:48461163-48461185 AAGAGGAAGAAAAAGAAAGGAGG - Intergenic
1139355645 16:66365786-66365808 CAGAAGAACCAAGAGGCTGGGGG - Intergenic
1139495315 16:67312680-67312702 CTGAGCAACCAGATGAATGGTGG - Intronic
1140643484 16:77003964-77003986 CAGTGGAAGCAAGAGAATTGAGG - Intergenic
1143882900 17:10043348-10043370 CAGAGAAACCAAATGAAGAGGGG + Intronic
1144580723 17:16457620-16457642 CATTAGAACCAATAGAATGGTGG + Intronic
1144646807 17:16980789-16980811 CAAAGGAATCAAAAGCTTGGGGG - Intergenic
1145070681 17:19803896-19803918 CAGAGCACCCAATAGAGTGGAGG - Intronic
1146503111 17:33381322-33381344 CTGAGGCACCAAGAGCATGGGGG + Intronic
1146971561 17:37076868-37076890 CATAGAAACTGAAAGAATGGTGG - Intergenic
1147547331 17:41412161-41412183 CAGAGGTAGGAAAAGAATGTGGG - Intergenic
1148245806 17:46029815-46029837 CAGAGTACCCCAAAGAACGGCGG + Intergenic
1148385697 17:47233115-47233137 AAGAGTGACCCAAAGAATGGCGG - Intergenic
1148720399 17:49748482-49748504 CTGAGGAATCAAGAGAATGGTGG + Intronic
1150591983 17:66571154-66571176 GAAAGTAACCAACAGAATGGAGG + Intronic
1151394790 17:73815671-73815693 CAGAAGACCCAAAAGAAAAGAGG + Intergenic
1151739429 17:75969848-75969870 GAAAGGAACGAAAGGAATGGAGG + Intronic
1152159382 17:78657967-78657989 CAGAAGGACCAAAACCATGGAGG + Intergenic
1152163157 17:78682219-78682241 CACTGGAACCAAAATTATGGAGG + Intronic
1152442446 17:80317273-80317295 CAAAGGTACCAAAAGTTTGGGGG + Exonic
1152813571 17:82393855-82393877 CAGAGGCACCAAAGGACAGGGGG + Intronic
1153026261 18:675689-675711 CAGAGGAACCCAAATAATTCTGG - Intronic
1153413146 18:4816376-4816398 CAGAGGGACCCCATGAATGGGGG - Intergenic
1154049094 18:10936443-10936465 CTTAGGAAACCAAAGAATGGAGG + Intronic
1155488130 18:26369667-26369689 CAGAGGAGCCAAAAGAGAAGAGG - Intronic
1156009260 18:32477019-32477041 CAGATGAATAAAAAGAATTGGGG - Intergenic
1156971297 18:43160201-43160223 CAGAGGAATAAAAATAATGATGG + Intergenic
1157164136 18:45342585-45342607 CAGAGCAACCAGATGAATGCAGG + Intronic
1158437701 18:57445166-57445188 CAAATGAACCAAAATAATTGTGG - Intronic
1158447545 18:57534180-57534202 CCCAGAAAACAAAAGAATGGAGG + Intergenic
1158663654 18:59412821-59412843 CCTAGGAACCAAAATAAAGGAGG - Intergenic
1158671196 18:59475509-59475531 CAGAATAAACAAAAGTATGGAGG - Intronic
1159311162 18:66711319-66711341 TAGAGAATCCTAAAGAATGGAGG - Intergenic
1160292441 18:77607048-77607070 CAGAGAAACAAACAGAATCGTGG + Intergenic
1164634583 19:29782888-29782910 TACAGTAACAAAAAGAATGGGGG + Intergenic
1164883336 19:31755391-31755413 CAGAGAAGCAAAAAGAATAGAGG - Intergenic
1165275748 19:34749717-34749739 TAAAGGAACAAAATGAATGGAGG + Intergenic
1166851511 19:45763648-45763670 CAGAGACAGCAAAAGAATTGAGG - Intronic
1168716551 19:58531847-58531869 AAGAGGTGCCCAAAGAATGGTGG - Intronic
927199430 2:20569124-20569146 CCGGGTAGCCAAAAGAATGGAGG + Intronic
927602816 2:24459313-24459335 CAGTGGAGGCAAAGGAATGGAGG + Intergenic
930284140 2:49406892-49406914 CAAAGGAAACAATAGAATGAAGG - Intergenic
930326140 2:49921322-49921344 GAGAGGAAAAAAAAGTATGGAGG - Exonic
931400236 2:61924939-61924961 CAGAGGAACCAGAGGCCTGGAGG + Intronic
931853795 2:66280652-66280674 CAGAGAAATGAAAAGACTGGAGG - Intergenic
931946205 2:67310972-67310994 CACAGGAACAAAAAGAAAGAAGG - Intergenic
932414760 2:71566809-71566831 AAGATGAACCAAAAGAAGGGGGG + Intronic
934928798 2:98403486-98403508 CAGAGTAACCTAAACAATTGAGG + Intergenic
935695278 2:105766116-105766138 TAAAGGAAACAAAAGAATGAGGG + Intronic
935822315 2:106906545-106906567 CAGAGAAACAAAAATCATGGAGG - Intergenic
936099566 2:109563364-109563386 CAGAGTAAACAAAAGAAAGGGGG - Intronic
938881893 2:135598827-135598849 CAAAGGAAAGAAAAGGATGGGGG - Intronic
939547940 2:143576669-143576691 CAGAAGAATCAGAAGAAGGGAGG + Intronic
941137813 2:161739232-161739254 CAGATTAACCAGAAAAATGGAGG + Intronic
943727736 2:191269188-191269210 CATAGAGACAAAAAGAATGGTGG - Intronic
944028941 2:195208939-195208961 CAGAGGAGCAAAGACAATGGAGG - Intergenic
944044668 2:195395627-195395649 CATATGAACCAAAAGGATGATGG + Intergenic
945093809 2:206200426-206200448 CAAAGAAAGAAAAAGAATGGTGG + Intronic
945515043 2:210752919-210752941 CAGAGGACCCACAGGAAAGGAGG - Intergenic
946718797 2:222582230-222582252 CAGAGAAGTCAAAAGAAAGGAGG + Intronic
946812000 2:223535763-223535785 CAGAGGAACCAAGAAAAGAGTGG - Intergenic
947636360 2:231682518-231682540 CAGAGGACCCAGAAGAGAGGTGG - Intergenic
947820878 2:233068698-233068720 CAGAGGAGAGAAGAGAATGGGGG + Intronic
1169514061 20:6297099-6297121 CAGGGGCACCAAAGGAAGGGAGG + Intergenic
1169676033 20:8156119-8156141 CAGACAAAGCAAAAGAATGCAGG - Intronic
1169768569 20:9176163-9176185 TAGAGGAAACAATAGCATGGAGG - Intronic
1169939634 20:10923324-10923346 CAGAGTAACCCAACTAATGGGGG + Intergenic
1172420828 20:34816131-34816153 GAGAGTAACCAAAGGAATGATGG - Intronic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1174191352 20:48742879-48742901 CAGAGAAGCCAAAGGAATGAGGG + Intronic
1174772100 20:53309866-53309888 CCGAGGAAACAAAAGCAAGGAGG + Intronic
1175572749 20:60036621-60036643 CAGAGTAAGCAAAAGCCTGGAGG - Intergenic
1175590516 20:60186989-60187011 TACAGTAATCAAAAGAATGGTGG - Intergenic
1176193324 20:63824626-63824648 CAGAGCACCCAGAAGAACGGGGG - Intronic
1177182755 21:17760658-17760680 CAGAAGAACCAAAATAACAGTGG - Intergenic
1177488789 21:21794193-21794215 CTGAGGAACCAAGAGAATGCCGG - Intergenic
1177488848 21:21794784-21794806 AAGAGGAACAAAAAGAAGGTGGG - Intergenic
1177971830 21:27799350-27799372 CAGAGAGACCAACAGAATGCAGG + Intergenic
1178268550 21:31167917-31167939 CAGGGGAACCATATGAATGTGGG - Intronic
1178819099 21:35959188-35959210 CAGAGGAACCAGAAGAAAACAGG + Intronic
1178943309 21:36925566-36925588 CAGAGGAAGCAGAAGAAGGTGGG - Intronic
1180287489 22:10762280-10762302 AAGAATAACCAAAAAAATGGGGG - Intergenic
1184635146 22:45822087-45822109 GACAGGAAACAAAAGAATGCAGG - Intronic
949725768 3:7042515-7042537 CAGAGAAAAAGAAAGAATGGGGG - Intronic
951839008 3:27013474-27013496 TAGAGGAAGATAAAGAATGGGGG + Intergenic
953546090 3:43864546-43864568 AAGGGGAAGCAAAAGACTGGAGG - Intergenic
953913325 3:46903697-46903719 CAGATGGACCAAAAGATGGGTGG + Exonic
955399482 3:58581266-58581288 CAGAGGAACCCAAAGGAAGGGGG + Intronic
956914189 3:73853452-73853474 CAGAGGAACCAAAAGGAAAAAGG + Intergenic
956932555 3:74061415-74061437 CAAAGTAACCCATAGAATGGGGG - Intergenic
958842839 3:99229039-99229061 CAGAGGAATCAAAAGAAGGAAGG + Intergenic
959474511 3:106792258-106792280 CAGAGGAAACAAAAGAATAAAGG + Intergenic
959720240 3:109478823-109478845 GAGAGGAAGCAAAAGAGAGGAGG - Intergenic
963427858 3:145155209-145155231 GAGAGGGAGCAAAAGAGTGGGGG + Intergenic
965082889 3:164057681-164057703 AATAGTAACCAAAAGAAAGGAGG - Intergenic
966002343 3:174965750-174965772 CAGAGGAAGTTAGAGAATGGTGG + Intronic
966270570 3:178099648-178099670 AATAGAAAGCAAAAGAATGGAGG + Intergenic
967222860 3:187262830-187262852 CTGAGAAACCCAAAGAAAGGAGG + Intronic
967423651 3:189301565-189301587 CAGAAGAAGAAAAAAAATGGAGG - Intronic
968842829 4:3020672-3020694 CAGATGAACCCACAGAAGGGAGG - Intronic
969215281 4:5716888-5716910 CAGAGGAACAAAAGGAAAAGAGG - Intronic
970617177 4:17779305-17779327 AATAGTAGCCAAAAGAATGGTGG + Intronic
971409745 4:26357756-26357778 CATAGAGACAAAAAGAATGGTGG - Intronic
971551338 4:27960643-27960665 CAGAGCAGAGAAAAGAATGGTGG + Intergenic
972072070 4:35033355-35033377 CAGAGGAACAAAAAGAAAAAAGG + Intergenic
972356193 4:38281134-38281156 CCCAGGAACCAAAAGAAAGCAGG - Intergenic
973769282 4:54191788-54191810 CTGAGCAACCAGAAGAATGCAGG + Intronic
973938177 4:55872789-55872811 CACAGGAACCGAAAGAAAGTAGG - Intronic
975966822 4:79983877-79983899 TGGAGGAATTAAAAGAATGGAGG - Exonic
976498152 4:85754852-85754874 CAGAGGAACCAAAAAATTAAGGG - Intronic
976913383 4:90337662-90337684 CTGAGGATCAAAAAGAATGTTGG + Intronic
976926591 4:90505363-90505385 CAGAGGAACCAAAATCAAAGCGG + Intronic
977219203 4:94319335-94319357 AACAGGAACCAAAAGCATGCAGG - Intronic
978663256 4:111153253-111153275 AAAAGGAACCTAGAGAATGGAGG - Intergenic
978758000 4:112324957-112324979 CTGAGGAACCAAAAAAAAGGGGG + Intronic
978850666 4:113332107-113332129 CAGAAGAAGGAGAAGAATGGGGG - Intronic
979013732 4:115404299-115404321 CAGATGAACCTAAATAATGGTGG + Intergenic
980124296 4:128758978-128759000 CAGAGAAAGAAATAGAATGGAGG + Intergenic
980774982 4:137425936-137425958 CAGAGGTACGATAAGGATGGTGG - Intergenic
981048703 4:140290433-140290455 GAGTGGAACCAAAGGCATGGGGG - Intronic
981486152 4:145288691-145288713 CAGCGAAACCAAATGAAAGGTGG - Intergenic
981754084 4:148122379-148122401 CAAAGGGATCAAAAGAAAGGTGG - Intronic
981871743 4:149495130-149495152 CAGAGAAAGAAAAAGAATGAAGG + Intergenic
982217451 4:153094736-153094758 GAGAGAAACCAAAAGCATAGTGG - Intergenic
983488756 4:168362635-168362657 CAAAAGAACCAAAAAAATCGTGG + Intronic
984193273 4:176629491-176629513 CAGAGGAACCATAAAATTGGAGG + Intergenic
984542694 4:181060358-181060380 CAGAGGGAAGAAAAGGATGGGGG - Intergenic
985050310 4:185984176-185984198 CAGAGAAACAATAAGAATTGTGG - Intergenic
987975748 5:25012817-25012839 CAGAGGAAGCAAAAGAGAGATGG + Intergenic
988083679 5:26445299-26445321 CAGAGGACCCAAAATTTTGGGGG - Intergenic
988389931 5:30615250-30615272 CAAAAGAAACAAAACAATGGTGG - Intergenic
988434876 5:31162680-31162702 TAGAGGAAACAATAGAATTGGGG - Intergenic
988455246 5:31381729-31381751 AAGAGAAACCAAAAGCCTGGGGG - Intergenic
988719973 5:33868002-33868024 CAGAGGAGGAAAGAGAATGGAGG - Intronic
989144749 5:38237687-38237709 CAGAGGAATAAAAACAATGAAGG + Intergenic
989160277 5:38384417-38384439 AAGAGGAACCAACAGAATATGGG - Intronic
989619675 5:43371998-43372020 GAGAGGAAGCAAGAGAGTGGGGG + Intergenic
990153964 5:52853159-52853181 CAGAGCAACCAAAAAGATGTGGG + Intronic
992654420 5:78894180-78894202 CACAGGAACAAACAGAATTGTGG + Intronic
992971098 5:82058921-82058943 AAGAGAAACCAAAAGTATGACGG - Intronic
993069100 5:83135618-83135640 CACAGGAAGCAAAAAAATGGTGG - Intronic
993436493 5:87901939-87901961 CAGGAGAACCAGAAGAATGCAGG - Intergenic
993596580 5:89864097-89864119 CAGAGGACCTAAGAGCATGGAGG + Intergenic
993604586 5:89972887-89972909 CAGAGGAAGCATTTGAATGGTGG - Intergenic
993639480 5:90384159-90384181 CACAAGGACAAAAAGAATGGAGG - Intergenic
994622141 5:102176460-102176482 TAGAGAAAGCAAAACAATGGTGG - Intergenic
995341829 5:111069695-111069717 AAGAGGAAACAAAAAAAGGGAGG + Intergenic
996152092 5:120050820-120050842 AACACTAACCAAAAGAATGGTGG - Intergenic
996205654 5:120732334-120732356 CAGATCAACCAAAAAAATGGAGG - Intergenic
997660204 5:135583439-135583461 GAAAAGAACTAAAAGAATGGGGG - Intergenic
999574036 5:152954134-152954156 TAGAGGAAGTAAAAGAATGTGGG - Intergenic
999830228 5:155311881-155311903 CAGAGGAAACATATGAATGGTGG + Intergenic
1001029522 5:168251760-168251782 CAGTAGCAGCAAAAGAATGGTGG + Intronic
1001845184 5:174916000-174916022 CAGTGTAAGCAACAGAATGGAGG - Intergenic
1003166363 6:3682411-3682433 GAGAGGAACCAGAAGACTGGAGG - Intergenic
1003908365 6:10722427-10722449 TAGAGCAACTAAGAGAATGGTGG + Intergenic
1004004936 6:11629707-11629729 CAGAGGAACCACAGAACTGGTGG - Intergenic
1004397594 6:15259559-15259581 GAGAGATGCCAAAAGAATGGTGG + Intronic
1004423552 6:15492491-15492513 AAAAGGAAACAGAAGAATGGAGG - Intronic
1005331609 6:24756096-24756118 AAGAGAAACCAAAAGACTGAGGG - Intergenic
1006030324 6:31172834-31172856 CAGAGGCAACATAAGAGTGGGGG - Intronic
1006094882 6:31649646-31649668 CACAGGAATGGAAAGAATGGAGG + Intronic
1006246825 6:32744422-32744444 CAGAGGAAAAAAAAAAGTGGGGG + Intronic
1006279171 6:33033687-33033709 AAGAGCAACCAAAAGAAAGCTGG - Intergenic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007308873 6:40929174-40929196 GAAAAGAACCAAGAGAATGGGGG + Intergenic
1007600889 6:43080478-43080500 CAGAGGATCAAAAACACTGGGGG - Intronic
1008179953 6:48316094-48316116 CAGAGAAACCAAGAGAATGCTGG + Intergenic
1010543461 6:77121590-77121612 CAGAGGCTCCAAAGGAGTGGAGG + Intergenic
1010561973 6:77362004-77362026 GAGAGGAAGCAAAAGAGAGGAGG - Intergenic
1011041811 6:83037836-83037858 CTGGGGAACCAAAAGAATAAGGG + Intronic
1012008569 6:93749791-93749813 GGGAGGCACAAAAAGAATGGAGG + Intergenic
1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG + Intronic
1013093793 6:106925492-106925514 AAGAGAAAGAAAAAGAATGGAGG + Intergenic
1013762006 6:113529793-113529815 CAGAGTAAGAAAAAGTATGGGGG - Intergenic
1013795326 6:113881491-113881513 CAGATGAACCATAAAACTGGTGG + Intergenic
1017350113 6:153430507-153430529 GAGAGGAAGCAAGAGAGTGGGGG - Intergenic
1017623338 6:156321747-156321769 GATAGCAACCCAAAGAATGGGGG - Intergenic
1020788281 7:12594807-12594829 CAGAGGAACCAGAGGCCTGGAGG + Intronic
1022796489 7:33735508-33735530 CTGAGGAACTGAAAGAATGTGGG - Intergenic
1023672120 7:42588083-42588105 GAGAGGAAACAAGAGAATCGAGG - Intergenic
1026389731 7:69888351-69888373 GAGAGGAAACAAGAGGATGGGGG + Intronic
1027621003 7:80484934-80484956 GAGAGGTTCCAGAAGAATGGTGG - Intronic
1028187591 7:87805856-87805878 AAGAGAATCCAAAATAATGGTGG + Intronic
1029436240 7:100565500-100565522 CTGGGGAAGCAAAACAATGGGGG - Exonic
1029954692 7:104625533-104625555 CAGAGGAACAAAATTAAAGGAGG - Intronic
1031483618 7:122304950-122304972 CAGAGGAAGCAAAAGGGGGGTGG - Intronic
1031901298 7:127414519-127414541 GAGAGGAAACACAAGAGTGGAGG - Intronic
1031942737 7:127806476-127806498 CAGAAAAACCAAAAGAAGAGAGG - Intronic
1032166303 7:129547733-129547755 CAGAGGAAACAAAAAGGTGGAGG - Intergenic
1032401971 7:131629993-131630015 CAGAGGAGGGAACAGAATGGAGG + Intergenic
1033178895 7:139154792-139154814 CAGAGTAACCAAAACAATCTGGG - Intronic
1033398073 7:140994434-140994456 CAAATGAACAAAAAGACTGGAGG - Intergenic
1033995663 7:147343548-147343570 CAGAGCAACAAAATGAATGCTGG - Intronic
1034603201 7:152283163-152283185 AAGAATAACCAAAAAAATGGGGG - Intronic
1037481187 8:19307443-19307465 CAGAAGGATAAAAAGAATGGAGG - Intergenic
1037677277 8:21062117-21062139 GAGAGGAACTAGAACAATGGAGG - Intergenic
1038003106 8:23407137-23407159 CAGATGAAACAAAATGATGGCGG + Intronic
1038071649 8:24021443-24021465 CTGAGGAACAAAAAGAATGAAGG + Intergenic
1039937575 8:42059765-42059787 AACACGAACCAAAAGAATGATGG + Intergenic
1040500152 8:47998431-47998453 CAGAGGAACCAGAAGCCTGGAGG + Intergenic
1040999361 8:53435533-53435555 CAAAGGAAGAAAAAGATTGGGGG + Intergenic
1041213441 8:55576071-55576093 AAGAGGAAACAAACAAATGGAGG + Intergenic
1041472510 8:58226093-58226115 CAAAGGAACCAAAGGCATGTGGG - Intergenic
1042559472 8:70062259-70062281 CAGAGCAAGCAACAGAATGAGGG - Intronic
1043081935 8:75776859-75776881 CAGAGATACCAAAAGAAAGAAGG - Intergenic
1045344248 8:101280395-101280417 CAGAGAGACCCAAAGAAGGGAGG + Intergenic
1048886992 8:138916646-138916668 CAAAGGAAACAAAAGTCTGGAGG + Intergenic
1049026010 8:139989404-139989426 GAGAGGAAACAAAAGAGTAGAGG - Intronic
1051610406 9:18956464-18956486 CAGGGGATCCAGAAGACTGGTGG - Intronic
1051905295 9:22088031-22088053 CAGAAGAACTAAAAGAAAGGAGG + Intergenic
1051933494 9:22414881-22414903 AAGAGAAAACAAAAGAATAGAGG - Intergenic
1052430650 9:28362411-28362433 CAGAAGAATCAAAAGAAAAGAGG + Intronic
1052863263 9:33449723-33449745 CAGAGGGACCAAAAGAGAGAAGG + Intergenic
1055560278 9:77515375-77515397 TACAGGGACCAAAAGAAAGGAGG + Intronic
1057966587 9:99509850-99509872 CAGAGGAAGCAAAACATTTGGGG - Intergenic
1058170460 9:101674349-101674371 AAGAGGAAGCAAAAGAAAGAAGG - Intronic
1058505360 9:105660930-105660952 CAGTGGAACCATATGCATGGTGG - Intergenic
1058539089 9:105993347-105993369 CAGAGGAACAAGAAGCATTGAGG - Intergenic
1059846257 9:118280293-118280315 CAGAGTTAGCAAATGAATGGTGG - Intergenic
1060215616 9:121736685-121736707 CGGGGGAACCAAAAGATTTGGGG - Intronic
1062415648 9:136448280-136448302 CAGAGACACCAGGAGAATGGAGG + Intronic
1062415748 9:136448686-136448708 CAGAGACACCAGGAGAATGGAGG + Intronic
1185611188 X:1394556-1394578 AAGAGGAAAGAAAAGAAGGGAGG - Intergenic
1186093553 X:6075703-6075725 GAGAAGAAGCAAGAGAATGGGGG - Intronic
1186318166 X:8393699-8393721 CAGAGGCCACAAAAGATTGGTGG + Intergenic
1188475373 X:30586387-30586409 GAGAGGAAGCAACAGAAGGGAGG + Intergenic
1188694404 X:33172225-33172247 CAAAGGAAATAAAAGTATGGCGG - Intronic
1190788895 X:53681666-53681688 CTGAGGAACCAAACAAATGAGGG + Intronic
1191011849 X:55768491-55768513 CAGAGGAAAAAAAAGAATTAGGG + Intergenic
1191225308 X:58035830-58035852 GAGAAGAACCAAAAGAGTGTAGG - Intergenic
1192314346 X:70040347-70040369 CAGGGAAGCCAAAAGATTGGCGG - Intergenic
1193150856 X:78123167-78123189 CAGGGGAGCCAAAATGATGGAGG - Intronic
1194464550 X:94217344-94217366 CAGAAACACCAAAAGTATGGGGG - Intergenic
1194804830 X:98314433-98314455 CATAGGAAGAAAAAAAATGGTGG + Intergenic
1195222603 X:102760907-102760929 CAGATGAACAAAAAGCATGAAGG - Intergenic
1195791531 X:108593027-108593049 CAGTGGAAAACAAAGAATGGTGG - Intronic
1197295293 X:124711879-124711901 CATAGAAACAAATAGAATGGTGG - Intronic
1199765883 X:150941497-150941519 CAGAGGAGGGAAAAGACTGGAGG + Intergenic
1200053781 X:153447923-153447945 AAAAGAAACCAAAAGGATGGTGG + Intronic
1200735470 Y:6789155-6789177 TTGAGGATCCAAGAGAATGGTGG + Intergenic
1200969726 Y:9138246-9138268 CAAAGGAAAAAAAAGAATAGCGG + Intergenic
1201504636 Y:14684512-14684534 GAGAAGAAGCAAGAGAATGGGGG + Intronic
1201679584 Y:16629184-16629206 CAGAGGAACCAGAAGACAGGAGG + Intergenic
1201716783 Y:17053330-17053352 CAGAGAACCCAAAAGAAAGCAGG - Intergenic