ID: 1097806126

View in Genome Browser
Species Human (GRCh38)
Location 12:63966961-63966983
Sequence CAACTTATGAGACGTGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097806126_1097806129 7 Left 1097806126 12:63966961-63966983 CCATATTCACGTCTCATAAGTTG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1097806129 12:63966991-63967013 TCCTGAGCTTTTTGATAGGTTGG 0: 1
1: 0
2: 1
3: 20
4: 187
1097806126_1097806128 3 Left 1097806126 12:63966961-63966983 CCATATTCACGTCTCATAAGTTG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1097806128 12:63966987-63967009 TATGTCCTGAGCTTTTTGATAGG 0: 1
1: 0
2: 2
3: 20
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097806126 Original CRISPR CAACTTATGAGACGTGAATA TGG (reversed) Intronic
904965179 1:34366730-34366752 CACCTTTTGAGAGGTGAACAAGG + Intergenic
907933792 1:59023911-59023933 CAAATTATGAGACATAAATCAGG + Intergenic
907967951 1:59351680-59351702 GAACTAATGAGACCTGAATGAGG + Intronic
910227687 1:84953050-84953072 AAATTTATGAAATGTGAATAGGG + Intronic
913684326 1:121216855-121216877 CCACTAATGAGAAGTGATTAAGG - Intronic
914036165 1:144004470-144004492 CCACTAATGAGAAGTGATTAAGG - Intergenic
914153293 1:145063475-145063497 CCACTAATGAGAAGTGATTAAGG + Intronic
917504106 1:175612718-175612740 CCACTTATGAGATGAGAAAAAGG + Intronic
918849915 1:189674456-189674478 CAACTTAGGTTAAGTGAATAAGG - Intergenic
920471634 1:206235368-206235390 CCACTAATGAGAAGTGATTAAGG - Intronic
923967827 1:239162504-239162526 CAACATATGAAATGTGCATATGG + Intergenic
1072264667 10:93715584-93715606 CAAGCTGTGTGACGTGAATAAGG - Intergenic
1075243134 10:120796306-120796328 CAACTGATGAAATCTGAATATGG - Intergenic
1087221341 11:95549689-95549711 CATTTTATGAGACGAGAAGACGG - Intergenic
1090297977 11:125607014-125607036 CAACTTATGAAGCGTGACTTAGG + Intronic
1092642392 12:10528851-10528873 CAACTCATGAGACTAGAAAATGG + Intergenic
1097806126 12:63966961-63966983 CAACTTATGAGACGTGAATATGG - Intronic
1106185866 13:27409085-27409107 CAATATATGAGACTTGAAGAAGG + Intergenic
1109992394 13:70075113-70075135 CAAATTATGAGACTTGAAGAGGG + Intronic
1111241738 13:85483017-85483039 CAACTTATGAGACATGAGTTAGG - Intergenic
1111883546 13:93989220-93989242 CAACCTATGAGGTGTGAAAAGGG - Intronic
1117497582 14:56320803-56320825 CAACTAATGAGGCCTGGATAGGG - Intergenic
1133090882 16:3402800-3402822 CCACTTCTGAGACTTAAATAGGG - Intronic
1151010869 17:70494537-70494559 CAACTTAAGAAACCTGAAAATGG + Intergenic
1154549043 18:15653450-15653472 CAACTCCTGTGACGTGAATGCGG - Intergenic
1157923617 18:51739737-51739759 TAACTTAGGAGAAGTGATTATGG - Intergenic
1159033082 18:63251096-63251118 CAAAATATGAGACTTGAAGAAGG + Intronic
1165217924 19:34290026-34290048 CAACTTATGAGAGGTTTATCAGG - Intronic
926583581 2:14660299-14660321 CAAGTTCTCAGACGAGAATAGGG + Intergenic
932708397 2:74044901-74044923 CAAGTCATGAAATGTGAATATGG - Intronic
935587030 2:104810052-104810074 CAACTGATGAGCCTTGATTATGG + Intergenic
938985233 2:136569116-136569138 CTACTAATAAGACGTGCATAAGG + Intergenic
940699069 2:157019357-157019379 CAACTTTTCAGATGTGAGTAGGG + Intergenic
943236209 2:185323480-185323502 CAACTTATCAAGCCTGAATAAGG + Intergenic
945871228 2:215228571-215228593 CTGCTTATGAGATGTGAACAGGG - Intergenic
946963349 2:225008907-225008929 CAGCTTATGAGAGGTGGAAACGG - Intronic
947513444 2:230780384-230780406 CAACTGATGAAACTTGAAAAAGG - Intronic
1176524608 21:7856669-7856691 CAACTTATGAGAAGTTAACCAGG - Intergenic
1177968799 21:27762013-27762035 CAAAATATGAGACTTGAAAAGGG - Intergenic
1178658628 21:34486682-34486704 CAACTTATGAGAAGTTAACCAGG - Intergenic
1180915846 22:19486316-19486338 CAATTAAAGAGACCTGAATATGG - Intronic
1184146637 22:42615395-42615417 CTACTTTTTAGGCGTGAATAAGG - Intergenic
1184897122 22:47416347-47416369 CAACTGGTGAGGCATGAATAGGG + Intergenic
957525406 3:81373034-81373056 CAATTTATGAGAAATGAGTAGGG + Intergenic
957781833 3:84828644-84828666 AAACTTATGAGACCTGAAATTGG + Intergenic
960077198 3:113500422-113500444 CAACTGAGGAGATTTGAATATGG + Intronic
960978008 3:123195293-123195315 CAACTGATGATATTTGAATATGG - Intronic
963593440 3:147293994-147294016 CAAATTATGAGAAAAGAATAAGG - Intergenic
967605848 3:191445433-191445455 CAGCTTTTGAGATGTGAAAATGG + Intergenic
971652918 4:29302878-29302900 TAACTTATGAGATGGAAATATGG + Intergenic
972064201 4:34919255-34919277 CAACTGATGGGATGTGGATAAGG + Intergenic
976717814 4:88141713-88141735 AAACTTATGATTCGTGAATCAGG - Intronic
977718883 4:100215400-100215422 CAAGATATGAGACAAGAATATGG + Intergenic
979285465 4:118919355-118919377 CAAATTATGAGAGGGGAGTATGG - Intronic
982109257 4:152038614-152038636 CATCTGATGAAACGTGAAAAGGG + Intergenic
983855487 4:172638726-172638748 CAACTCATGAAATTTGAATAAGG - Intronic
984096891 4:175445594-175445616 CAACTTAGGACACGTGCAAAAGG - Intergenic
984122108 4:175758373-175758395 CAACTTTTAAGACATCAATAAGG + Intronic
987574175 5:19704486-19704508 CAACATATGATACGTGAAGAGGG + Intronic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
989428544 5:41324968-41324990 AAGGTTCTGAGACGTGAATATGG - Intronic
990771166 5:59247466-59247488 CACTTTAGGAGAGGTGAATATGG + Intronic
995783508 5:115803150-115803172 CAACTTCTCAGATGTGATTAAGG + Intergenic
999827159 5:155284707-155284729 CAAAATATGAGACTTGAAGAAGG - Intergenic
999909348 5:156180701-156180723 CAAATTATGAGACTTGAAGAGGG + Intronic
1004257827 6:14081167-14081189 CAAGGTATGAGACATGAAGAGGG + Intergenic
1006658118 6:35614276-35614298 TAACTAATGAGACTGGAATAGGG + Intronic
1008127954 6:47689901-47689923 CAAATTGTGAGAAGTGATTACGG + Intronic
1008790281 6:55223322-55223344 CAACTTATGAAAGGTAAGTAAGG - Intronic
1009723168 6:67502338-67502360 AAACTTATGAAACATTAATATGG - Intergenic
1016892226 6:149017966-149017988 GAACATATGAGAAGTGAATAGGG - Intronic
1020593692 7:10176210-10176232 AAACTTATGAAAATTGAATAAGG - Intergenic
1023507407 7:40914646-40914668 CAACTTCTAAGCTGTGAATAGGG - Intergenic
1026387198 7:69861842-69861864 CATCTTCTGAGACGGGAAAAAGG - Intronic
1026623491 7:71972075-71972097 CAACTAAAAAGAGGTGAATACGG + Intronic
1030386466 7:108873538-108873560 AAAATTATGAGTAGTGAATAGGG - Intergenic
1032104203 7:129011662-129011684 CAACTGGTGAAATGTGAATATGG + Intronic
1033879717 7:145865535-145865557 CAACTATTGAGATGAGAATAAGG + Intergenic
1038022973 8:23565537-23565559 CAACTTATGAAATGTAAAAAGGG + Intronic
1040840213 8:51776972-51776994 CAACTTATGATACGTCACTATGG + Intronic
1048388972 8:133942418-133942440 CAACTTATGAACCTTGAAGATGG - Intergenic
1061088309 9:128412044-128412066 CAACTCAGGAGACGTGAAGCTGG + Intronic
1186226191 X:7401415-7401437 CATCTTCTGAGACGTGATTTTGG + Intergenic
1188739309 X:33758035-33758057 CAACCTATCAGAATTGAATACGG - Intergenic
1192276817 X:69640573-69640595 CAACTTATGAGAGGGGAAGATGG - Intronic
1192324278 X:70119006-70119028 CAAATTATGAGACTTGTAGAAGG + Intergenic
1193631050 X:83888994-83889016 GAACTTTTGAGGAGTGAATACGG - Intergenic
1194078275 X:89425171-89425193 AAACTTATGCCACGTGGATAAGG + Intergenic
1200430920 Y:3080704-3080726 AAACTTATGCCACGTGGATAAGG + Intergenic